National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3254R-3 
 Symbol pgant2  Full Name polypeptide GalNAc transferase 2 
 CG No CG3254  Old CG No CG3254 
 Synonyms unnamed, CG3254, pgant2 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pharate adult pupal lehal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGGCTCCGTTAAGGACTTCG 
 Primer Seq. 3'
aatctagaggtaccCACCTTGTCAATCTTCGCCAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

3254R-3.IR full       1   TCGGCTCCGTTAAGGACTTCGAGCGCAATGCGGTCCACGGCCTCAAATTGAATGGGATTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3254R-3.in silico     1   TCGGCTCCGTTAAGGACTTCGAGCGCAATGCGGTCCACGGCCTCAAATTGAATGGGATTG 60


3254R-3.IR full       61  TGGCTCTGGAGGAGACATCGCAGGGTCTCAGTGGCGGAACAGGTGGACCTGGTGGTCGCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3254R-3.in silico     61  TGGCTCTGGAGGAGACATCGCAGGGTCTCAGTGGCGGAACAGGTGGACCTGGTGGTCGCT 120


3254R-3.IR full       121 TGCCAGTGGCGCCAAGTGGTCGTGGCACCGAGGTTGAGTACTTCAATGAGGCGGGCTACA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3254R-3.in silico     121 TGCCAGTGGCGCCAAGTGGTCGTGGCACCGAGGTTGAGTACTTCAATGAGGCGGGCTACA 180


3254R-3.IR full       181 TTCGGGCGGGTGCTCTACGCAATGGCGAAGATCCCTATATTAGGAATCGCTTCAATCAGG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3254R-3.in silico     181 TTCGGGCGGGTGCTCTACGCAATGGCGAAGATCCCTATATTAGGAATCGCTTCAATCAGG 240


3254R-3.IR full       241 AGGCCAGCGATGCTCTGCCCAGCAATCGGGATATACCCGACACCAGAAATCCCATGTGTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3254R-3.in silico     241 AGGCCAGCGATGCTCTGCCCAGCAATCGGGATATACCCGACACCAGAAATCCCATGTGTC 300


3254R-3.IR full       301 GTACCAAGAAGTACCGCGAAGATCTACCGGAGACGAGTGTCATCATTACCTTCCACAACG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3254R-3.in silico     301 GTACCAAGAAGTACCGCGAAGATCTACCGGAGACGAGTGTCATCATTACCTTCCACAACG 360


3254R-3.IR full       361 AGGCGAGGTCCACTTTGCTGCGAACCATTGTGAGTGTCCTTAACCGCAGTCCCGAGCATT 420
                          |||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||
3254R-3.in silico     361 AGGCGAGGTCCACTTTGCTGCGAACCATCGTGAGTGTCCTTAACCGAAGTCCCGAGCATT 420


3254R-3.IR full       421 TGATACGCGAAATCGTCCTGGTAGATGACTACAGTGATCATCCTGAGGATGGTCTGGAGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3254R-3.in silico     421 TGATACGCGAAATCGTCCTGGTAGATGACTACAGTGATCATCCTGAGGATGGTCTGGAGC 480


3254R-3.IR full       481 TGGCGAAGATTGACAAGGTG 500
                          ||||||||||||||||||||
3254R-3.in silico     481 TGGCGAAGATTGACAAGGTG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_134929.2  polypeptide GalNAc transferase 2 CG3254-RA (pgant2), mRNA 
NM_079738.2  DNA polymerase epsilon CG6768-RA (DNApol-epsilon), mRNA 
NM_134518.2  CG11943-RA, transcript variant A (CG11943), mRNA 
NM_167687.1  CG11943-RB, transcript variant B (CG11943), mRNA 
NM_141474.2  CG2616-RA (CG2616), mRNA 
NM_133111.1  CG7358-RA (CG7358), mRNA 
NM_132647.1  Inositol 1,4,5-triphosphate kinase 2 CG1630-RA, transcript variant A (IP3K2), mRNA 
NM_167358.1  Inositol 1,4,5-triphosphate kinase 2 CG1630-RB, transcript variant B (IP3K2), mRNA 
NM_176034.1  rickets CG8930-RE, transcript variant E (rk), mRNA 
NM_170526.2  CG31012-RC, transcript variant C (CG31012), mRNA 
NM_134276.1  rickets CG8930-RC, transcript variant C (rk), mRNA 
NM_130502.2  Protein O-mannosyltransferase 2 CG12311-RA (Pomt2), mRNA 
NM_134275.1  rickets CG8930-RB, transcript variant B (rk), mRNA 
NM_134277.1  rickets CG8930-RD, transcript variant D (rk), mRNA 
NM_057354.2  rickets CG8930-RA, transcript variant A (rk), mRNA 
NM_167218.1  CG32685-RC (CG32685), mRNA 
NM_168614.2  Protein disulfide isomerase CG6988-RD, transcript variant D (Pdi), mRNA 
NM_079355.2  Protein disulfide isomerase CG6988-RA, transcript variant A (Pdi), mRNA 
NM_001042802.1  CG34104-RA, transcript variant A (CG34104), mRNA 
NM_001042801.1  CG34104-RB, transcript variant B (CG34104), mRNA 
13  NM_133073.2  UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 CG6394-RA, transcript variant A (GalNAc-T2), mRNA 
13  NM_167623.1  UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferase 2 CG6394-RB, transcript variant B (GalNAc-T2), mRNA 
NM_164546.1  odd skipped CG3851-RA (odd), mRNA 
NM_139594.1  CG11593-RA (CG11593), mRNA 
NM_142531.1  CG14282-RA (CG14282), mRNA 
NM_142649.2  CG4000-RA (CG4000), mRNA 
NM_140846.1  CG14089-RA (CG14089), mRNA 
NM_142354.1  CG4090-RA (CG4090), mRNA 
NM_079657.2  Sarcoplasmic calcium-binding protein 2 CG14904-RA (Scp2), mRNA 
NM_166674.1  CG4589-RA, transcript variant A (CG4589), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.