National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3253R-2 
 Symbol CG3253  Full Name CG3253 
 CG No CG3253  Old CG No CG3253 
 Synonyms BEST:GH04269, CG3253 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCGCGTCTCTGGCCTTCGATA 
 Primer Seq. 3'
aatctagaggtaccGCGTGCCAGGTTCCTCATGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

3253R-2.IR full       1   CCGCGTCTCTGGCCTTCGATAACNTCGACTTGAGCTACGGCCGCTGGGACAACCAGCTGC 60
                          ||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||
3253R-2.in silico     1   CCGCGTCTCTGGCCTTCGATAACATCAACTTGAGCTACGGCCGCTGGGACAACCAGCTGC 60


3253R-2.IR full       61  TGTACAGGATCAAAGACTTTGCTCTGCTAGGCGAGCAGTACGTAGACTCTTCGGAGGGCA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
3253R-2.in silico     61  TGTACAGGATCAAAGACTTTGCTCTGCTAGGCGAGCAGTACGTAGACTCCTCGGAGGGCA 120


3253R-2.IR full       121 GCTTGGTGTGCCTGGCCACCCAGACTTCAGTGGAGCGCCTCAACTCGCTTCCCCAGGTGG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3253R-2.in silico     121 GCTTGGTGTGCCTGGCCACCCAGACTTCAGTGGAGCGCCTCAACTCGCTTCCCCAGGTGG 180


3253R-2.IR full       181 CNGCCAATTGGCAGGGCAAGATGTCCGTGGCCCTGTTTGCAGCTGGGCCCGAGGAGTTTG 240
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3253R-2.in silico     181 CAGCCAATTGGCAGGGCAAGATGTCCGTGGCCCTGTTTGCAGCTGGGCCCGAGGAGTTTG 240


3253R-2.IR full       241 TAGTCCTGCAATACTTCGTTACCTATATGCGCCTGTGCTTCGCGAACATACGCGAGAATG 300
                          ||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||
3253R-2.in silico     241 TAGTCCTGCAATACTTCGTTACCTATATGCGCCTGTGCTTCGCAAACATACGCGAGAATG 300


3253R-2.IR full       301 CCACCTTTCACTTGCTCACGCCTAGGGACTTCGACAAGCTGCCCCGTGTAGCCGCACTTC 360
                          ||||||||||||||||||| || ||||||||||||||||||||||| |||||||||||||
3253R-2.in silico     301 CCACCTTTCACTTGCTCACACCGAGGGACTTCGACAAGCTGCCCCGAGTAGCCGCACTTC 360


3253R-2.IR full       361 CCCTTAACATGAGGGGCAAATTCGACTGCCAGTACCCGGATAGGACGCTCAAGGCCCTGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3253R-2.in silico     361 CCCTTAACATGAGGGGCAAATTCGACTGCCAGTACCCGGATAGGACGCTCAAGGCCCTGC 420


3253R-2.IR full       421 TCAAGTTCCGCTCCCTGAAGACCCTGCAGTGGCGACAGAGGAACACCTATCCGCAGAACC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3253R-2.in silico     421 TCAAGTTCCGCTCCCTGAAGACCCTGCAGTGGCGACAGAGGAACACCTATCCGCAGAACC 480


3253R-2.IR full       481 ACATGAGGAACCTGGCACGC 500
                          ||||||||||||||||||||
3253R-2.in silico     481 ACATGAGGAACCTGGCACGC 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_138042.2  CG3253-RA (CG3253), mRNA 
0.2  NM_142545.1  CG3734-RA (CG3734), mRNA 
NM_136895.2  CG13176-RA (CG13176), mRNA 
NM_143576.1  CG15547-RA (CG15547), mRNA 
NM_057674.2  Mlh1 CG11482-RA (Mlh1), mRNA 
NM_079135.2  epithelial membrane protein CG2727-RA, transcript variant A (emp), mRNA 
NM_166703.1  epithelial membrane protein CG2727-RC, transcript variant C (emp), mRNA 
NM_166702.1  epithelial membrane protein CG2727-RB, transcript variant B (emp), mRNA 
NM_136013.1  beethoven CG15148-RA, transcript variant A (btv), mRNA 
NM_001042905.1  beethoven CG15148-RC, transcript variant C (btv), mRNA 
NM_001042904.1  beethoven CG15148-RB, transcript variant B (btv), mRNA 
NM_138254.2  CG9153-RB, transcript variant B (CG9153), mRNA 
NM_167868.1  CG9153-RA, transcript variant A (CG9153), mRNA 
NM_165230.1  Cadherin-N CG7100-RG, transcript variant G (CadN), mRNA 
NM_165229.1  Cadherin-N CG7100-RA, transcript variant A (CadN), mRNA 
NM_134481.1  CG14220-RA (CG14220), mRNA 
NM_165231.1  Cadherin-N CG7100-RE, transcript variant E (CadN), mRNA 
NM_001032106.1  Cadherin-N CG7100-RL, transcript variant L (CadN), mRNA 
NM_001032108.1  Cadherin-N CG7100-RJ, transcript variant J (CadN), mRNA 
NM_165228.1  Cadherin-N CG7100-RC, transcript variant C (CadN), mRNA 
NM_001032109.1  Cadherin-N CG7100-RI, transcript variant I (CadN), mRNA 
NM_001032107.1  Cadherin-N CG7100-RK, transcript variant K (CadN), mRNA 
NM_167121.1  CG9650-RC, transcript variant C (CG9650), mRNA 
NM_167123.2  CG9650-RA, transcript variant A (CG9650), mRNA 
NM_132157.1  CG9650-RB, transcript variant B (CG9650), mRNA 
NM_165851.2  CG30038-RA (CG30038), mRNA 
NM_137732.2  CG9754-RA (CG9754), mRNA 
NM_169503.1  CG32473-RA, transcript variant A (CG32473), mRNA 
NM_136410.3  CG30159-RA, transcript variant A (CG30159), mRNA 
NM_206046.1  CG30159-RB, transcript variant B (CG30159), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.