National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3244R-1 
 Symbol CG3244  Full Name CG3244 
 CG No CG3244  Old CG No CG3244 
 Synonyms CG3244 
 Accession No (Link to NCBI) NM_135014.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Zuber R, Shaik KS, Meyer F, Ho HN, Speidel A, Gehring N, Bartoszewski S, Schwarz H, Moussian B.
The putative C-type lectin Schlaff ensures epidermal barrier compactness in Drosophila.
Sci Rep (2019) 9(1) 5374 [ PubMed ID = 30926832 ] [ RRC reference ]

Lv X, Chen H, Zhang S, Zhang Z, Pan C, Xia Y, Fan J, Wu W, Lu Y, Zhang L, Wu H, Zhao Y.
Fsh-Pc-Sce complex mediates active transcription of Cubitus interruptus (Ci).
J Mol Cell Biol (2018) 10(5) 437-447 [ PubMed ID = 29432547 ] [ RRC reference ]

Shibata T, Ariki S, Shinzawa N, Miyaji R, Suyama H, Sako M, Inomata N, Koshiba T, Kanuka H, Kawabata S.
Protein crosslinking by transglutaminase controls cuticle morphogenesis in Drosophila.
PLoS ONE (2010) 5(10) e13477 [ PubMed ID = 20976106 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCCAGAACCACAACGACAACA 
 Primer Seq. 3'
aatctagaggtaccTCAACACGGACAGGCACTGCT 
 Predicted Fragment Size
511 
 IR fragment full Seq
0001 gcCAGTAAAC CACAACGACA ACAGCGACCA AGCCGGGTCG TCTTCCTCTC NCTGCCCGTG 
0061 CCCAGCCAAT GGTGNGCTAg cNGTCCCAAG GAGTTCTCCT ACCGCGGCAA AAACATGTTC 
0121 CTAACCACNC ACGTGCCCGC GNTNNCCAAC AAGAAGGTCG ATTGGTTGGA TGGTCGCAAT 
0181 CTGTGCCNCG ANTACTGCAT GGATCTGGTC GCCCTGGAGA CTCAGGAGAA GAACAATCTG 
0241 ATCTTCCGCG TGATCCAGCA GAACGATGTG CCGTACATCT GGACGGCCGG ACGTATCTGT 
0301 GaCTTTGCTG GCTGCGAGAA TCGTCCAGAT TTGGAGCCCA AGACCGTCTA TGGATGGTTC 
0361 TGGTCCGCAA CCCGCGAGAA GATCCAGGCC ACCAACCGCA TNCCACAGGG CTGGGGCTAC 
0421 AACCCATGGT CGCAGACTGG CCACAAGAAG CGCCCGCAGC CGGACAACGC CGAATACGAC 
0481 ATCAACCAGA CCAAGGAGCA GTGCCTGTCC GTGTTGA 
 in silico PCR Fragment
0001 GCCAG--AAC CACAACGACA ACAGCGACCA AGCCGGGTCG -CTTCCTCTC ACTGCCCGTG 
0061 CCC-GCCAA- -GTGCGCTAG CCGTCCCAAG GAGTTCTCCT ACCGCGGCAA AAACATGTTC 
0121 CTAACCACCC ACGTGCCCGC GCTGGCCAAC AAGAAGGTCG ATTGGTTGGA TGGTCGCAAT 
0181 CTGTGCCGCG AGTACTGCAT GGATCTGGTC GCCCTGGAGA CTCAGGAGAA GAACAATCTG 
0241 ATCTTCCGCG TGATCCAGCA GAACGATGTG CCGTACATCT GGACGGCCGG ACGTATCTGT 
0301 GACTTTGCTG GCTGCGAGAA TCGTCCAGAT TTGGAGCCCA AGACCGTCTA TGGATGGTTC 
0361 TGGTCCGCAA CCCGCGAGAA GATCCAGGCC ACCAACCGCA TCCCACAGGG CTGGGGCTAC 
0421 AACCCATGGT CGCAGACTGG CCACAAGAAG CGCCCGCAGC CGGACAACGC CGAATACGAC 
0481 ATCAACCAGA CCAAGGAGCA GTGCCTGTCC GTGTTGA 
 Assemble Data

3244R-1.IR_full       1   GCCAGTAAACCACAACGACAACAGCGACCAAGCCGGGTCGTCTTCCTCTCNCTGCCCGTG 60
                          |||||  ||||||||||||||||||||||||||||||||| ||||||||| |||||||||
3244R-1.in silico     1   GCCAG--AACCACAACGACAACAGCGACCAAGCCGGGTCG-CTTCCTCTCACTGCCCGTG 60


3244R-1.IR_full       61  CCCAGCCAATGGTGNGCTAGCNGTCCCAAGGAGTTCTCCTACCGCGGCAAAAACATGTTC 120
                          ||| |||||  ||| |||||| ||||||||||||||||||||||||||||||||||||||
3244R-1.in silico     61  CCC-GCCAA--GTGCGCTAGCCGTCCCAAGGAGTTCTCCTACCGCGGCAAAAACATGTTC 120


3244R-1.IR_full       121 CTAACCACNCACGTGCCCGCGNTNNCCAACAAGAAGGTCGATTGGTTGGATGGTCGCAAT 180
                          |||||||| |||||||||||| |  |||||||||||||||||||||||||||||||||||
3244R-1.in silico     121 CTAACCACCCACGTGCCCGCGCTGGCCAACAAGAAGGTCGATTGGTTGGATGGTCGCAAT 180


3244R-1.IR_full       181 CTGTGCCNCGANTACTGCATGGATCTGGTCGCCCTGGAGACTCAGGAGAAGAACAATCTG 240
                          ||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||
3244R-1.in silico     181 CTGTGCCGCGAGTACTGCATGGATCTGGTCGCCCTGGAGACTCAGGAGAAGAACAATCTG 240


3244R-1.IR_full       241 ATCTTCCGCGTGATCCAGCAGAACGATGTGCCGTACATCTGGACGGCCGGACGTATCTGT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3244R-1.in silico     241 ATCTTCCGCGTGATCCAGCAGAACGATGTGCCGTACATCTGGACGGCCGGACGTATCTGT 300


3244R-1.IR_full       301 GACTTTGCTGGCTGCGAGAATCGTCCAGATTTGGAGCCCAAGACCGTCTATGGATGGTTC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3244R-1.in silico     301 GACTTTGCTGGCTGCGAGAATCGTCCAGATTTGGAGCCCAAGACCGTCTATGGATGGTTC 360


3244R-1.IR_full       361 TGGTCCGCAACCCGCGAGAAGATCCAGGCCACCAACCGCATNCCACAGGGCTGGGGCTAC 420
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
3244R-1.in silico     361 TGGTCCGCAACCCGCGAGAAGATCCAGGCCACCAACCGCATCCCACAGGGCTGGGGCTAC 420


3244R-1.IR_full       421 AACCCATGGTCGCAGACTGGCCACAAGAAGCGCCCGCAGCCGGACAACGCCGAATACGAC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3244R-1.in silico     421 AACCCATGGTCGCAGACTGGCCACAAGAAGCGCCCGCAGCCGGACAACGCCGAATACGAC 480


3244R-1.IR_full       481 ATCAACCAGACCAAGGAGCAGTGCCTGTCCGTGTTGA 517
                          |||||||||||||||||||||||||||||||||||||
3244R-1.in silico     481 ATCAACCAGACCAAGGAGCAGTGCCTGTCCGTGTTGA 517

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   493  NM_135014.2  CG3244-RA (CG3244), mRNA 
0   NM_134692.2  CG2813-RA (CG2813), mRNA 
0   NM_078604.3  CG32592-RA (hiw), mRNA 
0   NM_141281.2  CG2087-RA (PEK), mRNA 
0   NM_143497.2  CG7896-RA (CG7896), mRNA 
0   NM_057644.2  CG10844-RB, transcript variant B (Rya-r44F), mRNA 
0   NM_057643.2  CG10844-RA, transcript variant A (Rya-r44F), mRNA 
0   NM_057645.2  CG10844-RC, transcript variant C (Rya-r44F), mRNA 
0   NM_057646.2  CG10844-RD, transcript variant D (Rya-r44F), mRNA 
0   NM_001038822.1  CG31732-RG, transcript variant G (yuri), mRNA 
0   NM_001038820.1  CG31732-RE, transcript variant E (yuri), mRNA 
0   NM_165107.2  CG31732-RC, transcript variant C (yuri), mRNA 
0   NM_001038821.1  CG31732-RF, transcript variant F (yuri), mRNA 
0   NM_165106.4  CG31732-RB, transcript variant B (yuri), mRNA 
0   NM_165109.2  CG31732-RD, transcript variant D (yuri), mRNA 
0   NM_001038823.2  CG31732-RH, transcript variant H (yuri), mRNA 
0   NM_141694.1  CG8516-RA (CG8516), mRNA 
0   NM_137123.2  CG17390-RA (CG17390), mRNA 
0   10  NM_132068.1  CG15899-RB (Ca-alpha1T), mRNA 
0   NM_133126.1  CG7556-RA (CG7556), mRNA 
0   NM_166757.1  CG1710-RC, transcript variant C (Hcf), mRNA 
0   NM_166756.1  CG1710-RB, transcript variant B (Hcf), mRNA 
0   NM_079882.2  CG1710-RA, transcript variant A (Hcf), mRNA 
0   NM_205873.1  CG1710-RD, transcript variant D (Hcf), mRNA 
0   NM_057253.3  CG4158-RA (wor), mRNA 
0   NM_138103.2  CG3608-RA (CG3608), mRNA 
0   12  NM_001032249.1  CG30084-RF, transcript variant F (CG30084), mRNA 
0   NM_136787.1  CG12943-RA (CG12943), mRNA 
0   NM_134763.1  CG14351-RA (CG14351), mRNA 
0   NM_141402.1  CG15186-RA, transcript variant A (CG15186), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.