National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32443R-4 
 Symbol Pc  Full Name Polycomb 
 CG No CG32443  Old CG No CG32443 
 Synonyms CG32443, PC, dPC, Pc-G, DmPc, CG7618, Pc, PcG 
 Accession No (Link to NCBI) NM_079475.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
[Please submit your publication]
Wang L, Jahren N, Miller EL, Ketel CS, Mallin DR, Simon JA.
Comparative analysis of chromatin binding by Sex Comb on Midleg (SCM) and other polycomb group repressors at a Drosophila Hox gene.
Mol. Cell. Biol. (2010) 30(11) 2584-93 [ PubMed ID = 20351181 ] [ RRC reference ]

Lv X, Han Z, Chen H, Yang B, Yang X, Xia Y, Pan C, Fu L, Zhang S, Han H, Wu M, Zhou Z, Zhang L, Li L, Wei G, Zhao Y.
A positive role for polycomb in transcriptional regulation via H4K20me1.
Cell Res. (2016) 26(5) 529-42 [ PubMed ID = 27002220 ] [ RRC reference ]

Lv X, Han Z, Chen H, Yang B, Yang X, Xia Y, Pan C, Fu L, Zhang S, Han H, Wu M, Zhou Z, Zhang L, Li L, Wei G, Zhao Y.
A positive role for polycomb in transcriptional regulation via H4K20me1.
Cell Res. (2017) 27(4) 594 [ PubMed ID = 28386086 ] [ RRC reference ]

Lv X, Chen H, Zhang S, Zhang Z, Pan C, Xia Y, Fan J, Wu W, Lu Y, Zhang L, Wu H, Zhao Y.
Fsh-Pc-Sce complex mediates active transcription of Cubitus interruptus (Ci).
J Mol Cell Biol (2018) 10(5) 437-447 [ PubMed ID = 29432547 ] [ RRC reference ]

Zhang S, Pan C, Lv X, Wu W, Chen H, Wu W, Wu H, Zhang L, Zhao Y.
Repression of Abd-B by Polycomb is critical for cell identity maintenance in adult Drosophila testis.
Sci Rep (2017) 7(1) 5101 [ PubMed ID = 28698559 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGTCGAGGCAAGGGGAGTAAGGGGAAGTTGGGGCGCGACAATGCGACCGACGATCCAGTC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GATCTAGTGTACGCGGCTGAGAAAATCATCCAAAAGCGCGTTAAGAAGGGCGTCGTGGAG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TACCGTGTCAAGTGGAAGGGCTGGAACCAGCGCTACAACACCTGGGAACCGGAGGTAAAC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATCCTGGATCGCCGCCTCATCGACATCTACGAACAAACGAACAAATCCTCCGGAACTCCC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCCAAGCGAGGCATTAAGAAGAAGGAGAAAGAACCCGATCCGGAGCCGGAATCCGAGGAG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GATGAGTACACCTTCACCGAAAACGATGTGGACACGCATCAAGCCACCACCTCATCGGCT 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 ACCCACGATAAGGAGTCGAAGAAGGAGAAGAAGCACCATCACCACCACCACCATCATCAC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CACATCAAGTCCGAACGCAACAGTGGACGGCGCTCGGAATCTCCGCTGACCCACCATCAT 480

32443R-4.IR_full       481 CATCACCACCACCACGATGTC 501
                           ||||||||||||||||| ||| silico     481 CATCACCACCACCACGA-GTC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  42  66  NM_079475.2  CG32443-RA (Pc), mRNA 
1.65   26  56  NM_132019.1  CG4096-RA (CG4096), mRNA 
1.45   11  27  61  NM_164403.1  CG4385-RA, transcript variant A (S), mRNA 
1.45   11  27  61  NM_078726.2  CG4385-RB, transcript variant B (S), mRNA 
1.24   33  40  NM_206688.1  CG32666-RA, transcript variant A (CG32666), mRNA 
1.24   33  40  NM_167288.1  CG32666-RB, transcript variant B (CG32666), mRNA 
1.03   19  29  69  NM_135957.2  CG31738-RB, transcript variant B (CG31738), mRNA 
1.03   19  29  65  NM_165168.1  CG31738-RA, transcript variant A (CG31738), mRNA 
1.03   40  84  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
1.03   40  81  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
1.03   20  66  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
1.03   20  66  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
1.03   20  66  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
1.03   18  53  NM_080105.2  CG31243-RF, transcript variant F (cpo), mRNA 
1.03   14  18  NM_079478.3  CG5069-RA (croc), mRNA 
0.82   31  74  NM_206567.1  CG6892-RB, transcript variant B (Ets96B), mRNA 
0.82   48  72  NM_136533.1  CG11641-RA (pdm3), mRNA 
0.82   13  20  NM_142103.1  CG14846-RA (CG14846), mRNA 
0.82   17  NM_001014742.1  CG6146-RC, transcript variant C (Top1), mRNA 
0.82   17  NM_078606.3  CG6146-RA, transcript variant A (Top1), mRNA 
0.82   23  61  NM_143196.1  CG8968-RA (CG8968), mRNA 
0.62   16  29  53  NM_168232.2  CG32369-RA, transcript variant A (CG32369), mRNA 
0.62   16  29  53  NM_139899.3  CG32369-RB, transcript variant B (CG32369), mRNA 
0.62   16  23  44  NM_164664.2  CG31645-RA (CG31645), mRNA 
0.62   11  48  96  NM_131924.2  CG4857-RB (CG4857), mRNA 
0.62   23  55  NM_205874.1  CG2052-RA, transcript variant A (CG2052), mRNA 
0.62   23  55  NM_166758.2  CG2052-RB, transcript variant B (CG2052), mRNA 
0.62   39  85  NM_132004.2  CG4136-RA (CG4136), mRNA 
0.62   16  30  NM_130587.1  CG14799-RA (CG14799), mRNA 
0.62   11  33  NM_166152.1  CG8448-RA, transcript variant A (mrj), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.