National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32443R-1 
 Symbol Pc  Full Name Polycomb 
 CG No CG32443  Old CG No CG32443 
 Synonyms CG32443, PC, dPC, Pc-G, DmPc, CG7618, Pc, PcG 
 Accession No (Link to NCBI) NM_079475.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Shih HT, Chen WY, Liu KY, Shih ZS, Chen YJ, Hsieh PC, Kuo KL, Huang KH, Hsu PH, Liu YW, Chan SP, Lee HH, Tsai YC, Wu JT.
dBRWD3 Regulates Tissue Overgrowth and Ectopic Gene Expression Caused by Polycomb Group Mutations.
PLoS Genet. (2016) 12(9) e1006262 [ PubMed ID = 27588417 ] [ RRC reference ]

Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGTCGAGGCAAGGGGAGTAAG 
 Primer Seq. 3'
aatctagaggtaccGACTCGTGGTGGTGGTGATGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGTCGAGGCA AGGGGAGTAA GGGGAAGTTG GGGCGCGACA ATGCGACCGA CGATCCAGTC 
0061 GATCTAGTGT ACGCGGCTGA GAAAATCATC CAAAAGCGCG TTAAGAAGGG CGTCGTGGAG 
0121 TACCGTGTCA AGTGGAAGGG CTGGAACCAG CGCTACAACA CCTGGGAACC GGAGGTAAAC 
0181 ATCCTGGATC GCCGCCTCAT CGACATCTAC GAACAAACGA ACAAATCCTC CGGAACTCCC 
0241 TCCAAGCGAG GCATTAAGAA GAAGGAGAAA GAACCCGATC CGGAGCCGGA ATCCGAGGAG 
0301 GATGAGTACA CCTTCACCGA AAACGATGTG GACACGCATC AAGCCACCAC CTCATCGGCT 
0361 ACCCACGATA AGGAGTCGAA GAAGGAGAAG AAGCACCATC ACCACCACCA CCATCATCAC 
0421 CACATCAAGT CCGAACGCAA CAGTGGACGG CGCTCGGAAT CTCCGCTGAC CCACCATCAT 
0481 CATCACCACC ACCACGATGT c 
 in silico PCR Fragment
0001 GGTCGAGGCA AGGGGAGTAA GGGGAAGTTG GGGCGCGACA ATGCGACCGA CGATCCAGTC 
0061 GATCTAGTGT ACGCGGCTGA GAAAATCATC CAAAAGCGCG TTAAGAAGGG CGTCGTGGAG 
0121 TACCGTGTCA AGTGGAAGGG CTGGAACCAG CGCTACAACA CCTGGGAACC GGAGGTAAAC 
0181 ATCCTGGATC GCCGCCTCAT CGACATCTAC GAACAAACGA ACAAATCCTC CGGAACTCCC 
0241 TCCAAGCGAG GCATTAAGAA GAAGGAGAAA GAACCCGATC CGGAGCCGGA ATCCGAGGAG 
0301 GATGAGTACA CCTTCACCGA AAACGATGTG GACACGCATC AAGCCACCAC CTCATCGGCT 
0361 ACCCACGATA AGGAGTCGAA GAAGGAGAAG AAGCACCATC ACCACCACCA CCATCATCAC 
0421 CACATCAAGT CCGAACGCAA CAGTGGACGG CGCTCGGAAT CTCCGCTGAC CCACCATCAT 
0481 CATCACCACC ACCACGA-GT C 
 Assemble Data

32443R-1.IR_full       1   GGTCGAGGCAAGGGGAGTAAGGGGAAGTTGGGGCGCGACAATGCGACCGACGATCCAGTC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32443R-1.in silico     1   GGTCGAGGCAAGGGGAGTAAGGGGAAGTTGGGGCGCGACAATGCGACCGACGATCCAGTC 60


32443R-1.IR_full       61  GATCTAGTGTACGCGGCTGAGAAAATCATCCAAAAGCGCGTTAAGAAGGGCGTCGTGGAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32443R-1.in silico     61  GATCTAGTGTACGCGGCTGAGAAAATCATCCAAAAGCGCGTTAAGAAGGGCGTCGTGGAG 120


32443R-1.IR_full       121 TACCGTGTCAAGTGGAAGGGCTGGAACCAGCGCTACAACACCTGGGAACCGGAGGTAAAC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32443R-1.in silico     121 TACCGTGTCAAGTGGAAGGGCTGGAACCAGCGCTACAACACCTGGGAACCGGAGGTAAAC 180


32443R-1.IR_full       181 ATCCTGGATCGCCGCCTCATCGACATCTACGAACAAACGAACAAATCCTCCGGAACTCCC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32443R-1.in silico     181 ATCCTGGATCGCCGCCTCATCGACATCTACGAACAAACGAACAAATCCTCCGGAACTCCC 240


32443R-1.IR_full       241 TCCAAGCGAGGCATTAAGAAGAAGGAGAAAGAACCCGATCCGGAGCCGGAATCCGAGGAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32443R-1.in silico     241 TCCAAGCGAGGCATTAAGAAGAAGGAGAAAGAACCCGATCCGGAGCCGGAATCCGAGGAG 300


32443R-1.IR_full       301 GATGAGTACACCTTCACCGAAAACGATGTGGACACGCATCAAGCCACCACCTCATCGGCT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32443R-1.in silico     301 GATGAGTACACCTTCACCGAAAACGATGTGGACACGCATCAAGCCACCACCTCATCGGCT 360


32443R-1.IR_full       361 ACCCACGATAAGGAGTCGAAGAAGGAGAAGAAGCACCATCACCACCACCACCATCATCAC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32443R-1.in silico     361 ACCCACGATAAGGAGTCGAAGAAGGAGAAGAAGCACCATCACCACCACCACCATCATCAC 420


32443R-1.IR_full       421 CACATCAAGTCCGAACGCAACAGTGGACGGCGCTCGGAATCTCCGCTGACCCACCATCAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32443R-1.in silico     421 CACATCAAGTCCGAACGCAACAGTGGACGGCGCTCGGAATCTCCGCTGACCCACCATCAT 480


32443R-1.IR_full       481 CATCACCACCACCACGATGTC 501
                           ||||||||||||||||| |||
32443R-1.in silico     481 CATCACCACCACCACGA-GTC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  42  66  NM_079475.2  CG32443-RA (Pc), mRNA 
1.65   26  56  NM_132019.1  CG4096-RA (CG4096), mRNA 
1.45   11  27  61  NM_164403.1  CG4385-RA, transcript variant A (S), mRNA 
1.45   11  27  61  NM_078726.2  CG4385-RB, transcript variant B (S), mRNA 
1.24   33  40  NM_206688.1  CG32666-RA, transcript variant A (CG32666), mRNA 
1.24   33  40  NM_167288.1  CG32666-RB, transcript variant B (CG32666), mRNA 
1.03   19  29  69  NM_135957.2  CG31738-RB, transcript variant B (CG31738), mRNA 
1.03   19  29  65  NM_165168.1  CG31738-RA, transcript variant A (CG31738), mRNA 
1.03   40  84  NM_079671.2  CG7847-RA, transcript variant A (sr), mRNA 
1.03   40  81  NM_169786.1  CG7847-RB, transcript variant B (sr), mRNA 
1.03   20  66  NM_169782.1  CG31243-RA, transcript variant A (cpo), mRNA 
1.03   20  66  NM_169781.1  CG31243-RE, transcript variant E (cpo), mRNA 
1.03   20  66  NM_169783.1  CG31243-RB, transcript variant B (cpo), mRNA 
1.03   18  53  NM_080105.2  CG31243-RF, transcript variant F (cpo), mRNA 
1.03   14  18  NM_079478.3  CG5069-RA (croc), mRNA 
0.82   31  74  NM_206567.1  CG6892-RB, transcript variant B (Ets96B), mRNA 
0.82   48  72  NM_136533.1  CG11641-RA (pdm3), mRNA 
0.82   13  20  NM_142103.1  CG14846-RA (CG14846), mRNA 
0.82   17  NM_001014742.1  CG6146-RC, transcript variant C (Top1), mRNA 
0.82   17  NM_078606.3  CG6146-RA, transcript variant A (Top1), mRNA 
0.82   23  61  NM_143196.1  CG8968-RA (CG8968), mRNA 
0.62   16  29  53  NM_168232.2  CG32369-RA, transcript variant A (CG32369), mRNA 
0.62   16  29  53  NM_139899.3  CG32369-RB, transcript variant B (CG32369), mRNA 
0.62   16  23  44  NM_164664.2  CG31645-RA (CG31645), mRNA 
0.62   11  48  96  NM_131924.2  CG4857-RB (CG4857), mRNA 
0.62   23  55  NM_205874.1  CG2052-RA, transcript variant A (CG2052), mRNA 
0.62   23  55  NM_166758.2  CG2052-RB, transcript variant B (CG2052), mRNA 
0.62   39  85  NM_132004.2  CG4136-RA (CG4136), mRNA 
0.62   16  30  NM_130587.1  CG14799-RA (CG14799), mRNA 
0.62   11  33  NM_166152.1  CG8448-RA, transcript variant A (mrj), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.