National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3242R-2 
 Symbol sob  Full Name sister of odd and bowl 
 CG No CG3242  Old CG No CG3242 
 Synonyms org1, CG3242, sob 
 Accession No (Link to NCBI) NM_057534.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Buchon N, Osman D, David FP, Fang HY, Boquete JP, Deplancke B, Lemaitre B.
Morphological and molecular characterization of adult midgut compartmentalization in Drosophila.
Cell Rep (2013) 3(5) 1725-38 [ PubMed ID = 23643535 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCACCGGCAGCAAGCAGCGATA 
 Primer Seq. 3'
aatctagaggtaccGGTGGTGGCGTTGTTGCTGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CACCgGCAGC AAGCAGCGAT ATTGCCGAgG CGCTTGGAGA ACTCAAGGCA AGCGCAACAG 
0061 CAGCAGCATC ATCAGCTAGC AAGGcAGCAA CATCGAAGCA CCACAGCAAC AACAACCACA 
0121 AGCCAAGTGC CGCAGNAACA GCCACAGCAG CGCACAAAGG AAAAGCGAGA GTTGCAACAG 
0181 CAACGNCAAA CAAGTGCACC GCTGCAACAT CGCCGATCgG NAGTNAAGAC CAGCAACgNA 
0241 GCCATGGNAG CTGCAACAGC AACGGCGGCC GCAGCAACCA ACGATCTTGC AGCGNCTGCT 
0301 GCGGTCGTTC TTTCGCTGCA AGGAACCATG GTCAGCAGTT TNCAGCAGGC NAGCGCCCTA 
0361 CTGCCGGCCA ATTCGGCGGC AGCAGCAGCT TCTTAATCTC CAGGCCCTGG AATCCTATTT 
0421 GGCGCTGCAG CGACTAACCg GGAAATCGGA TGTATTTCGC TTTTCCAACA GCAACACCGG 
0481 CAGCAGCAAC AGCAACAACG CCACCACC 
 in silico PCR Fragment
0001 CACCGGCAGC AAGCAGCGAT ATTGCCGAGG CGCTTGGAGA ACTCAAGGCA AGCGCAACAG 
0061 CAGCAGCATC ATCAGCTAGC AAGGCAGCAA CATCGAAGCA CCACAGCAAC AACAACCACA 
0121 AGCCAAGTGC CGCAGCAACA GCCACAGCAG CGCACAA--G AAAAGCGAGA GTTGCAACAG 
0181 CAACGGC-AA CAAGTGCACC GCTGCAACAT CGCCGATCGG CAGT-AAGAC CAGCAACGCA 
0241 GCCATGGCAG CTGCAACAGC AACGGCGGCC GCAGCAACCA ACGATCTTGC AGCGGCTGCT 
0301 GCGGTCGTTC TTTCGCTGCA AGGAACCATG GTCAGCAGTT TGCAGCAGGC ---CGCCCTA 
0361 CTGCCGGCCA ATTCGGCGGC AGCAGCAGC- TCTTAATCTC CAGGCCCTGG AATCCTATTT 
0421 GGCGCTGCAG CGACTAACCG GGAAATCGGA TGTATTTCGC TTTTCCAACA GCAACACCGG 
0481 CAGCAGCAAC AGCAACAACG CCACCACC 
 Assemble Data

3242R-2.IR_full       1   CACCGGCAGCAAGCAGCGATATTGCCGAGGCGCTTGGAGAACTCAAGGCAAGCGCAACAG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3242R-2.in silico     1   CACCGGCAGCAAGCAGCGATATTGCCGAGGCGCTTGGAGAACTCAAGGCAAGCGCAACAG 60


3242R-2.IR_full       61  CAGCAGCATCATCAGCTAGCAAGGCAGCAACATCGAAGCACCACAGCAACAACAACCACA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3242R-2.in silico     61  CAGCAGCATCATCAGCTAGCAAGGCAGCAACATCGAAGCACCACAGCAACAACAACCACA 120


3242R-2.IR_full       121 AGCCAAGTGCCGCAGNAACAGCCACAGCAGCGCACAAAGGAAAAGCGAGAGTTGCAACAG 180
                          ||||||||||||||| |||||||||||||||||||||  |||||||||||||||||||||
3242R-2.in silico     121 AGCCAAGTGCCGCAGCAACAGCCACAGCAGCGCACAA--GAAAAGCGAGAGTTGCAACAG 180


3242R-2.IR_full       181 CAACGNCAAACAAGTGCACCGCTGCAACATCGCCGATCGGNAGTNAAGACCAGCAACGNA 240
                          ||||| | |||||||||||||||||||||||||||||||| ||| ||||||||||||| |
3242R-2.in silico     181 CAACGGC-AACAAGTGCACCGCTGCAACATCGCCGATCGGCAGT-AAGACCAGCAACGCA 240


3242R-2.IR_full       241 GCCATGGNAGCTGCAACAGCAACGGCGGCCGCAGCAACCAACGATCTTGCAGCGNCTGCT 300
                          ||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||
3242R-2.in silico     241 GCCATGGCAGCTGCAACAGCAACGGCGGCCGCAGCAACCAACGATCTTGCAGCGGCTGCT 300


3242R-2.IR_full       301 GCGGTCGTTCTTTCGCTGCAAGGAACCATGGTCAGCAGTTTNCAGCAGGCNAGCGCCCTA 360
                          ||||||||||||||||||||||||||||||||||||||||| ||||||||   |||||||
3242R-2.in silico     301 GCGGTCGTTCTTTCGCTGCAAGGAACCATGGTCAGCAGTTTGCAGCAGGC---CGCCCTA 360


3242R-2.IR_full       361 CTGCCGGCCAATTCGGCGGCAGCAGCAGCTTCTTAATCTCCAGGCCCTGGAATCCTATTT 420
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||
3242R-2.in silico     361 CTGCCGGCCAATTCGGCGGCAGCAGCAGC-TCTTAATCTCCAGGCCCTGGAATCCTATTT 420


3242R-2.IR_full       421 GGCGCTGCAGCGACTAACCGGGAAATCGGATGTATTTCGCTTTTCCAACAGCAACACCGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3242R-2.in silico     421 GGCGCTGCAGCGACTAACCGGGAAATCGGATGTATTTCGCTTTTCCAACAGCAACACCGG 480


3242R-2.IR_full       481 CAGCAGCAACAGCAACAACGCCACCACC 508
                          ||||||||||||||||||||||||||||
3242R-2.in silico     481 CAGCAGCAACAGCAACAACGCCACCACC 508

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  14  98  NM_057534.3  CG3242-RA (sob), mRNA 
1.24   18  94  316  NM_142597.2  CG12254-RA (MED25), mRNA 
0.62   10  101  395  NM_169025.1  CG2534-RB, transcript variant B (cno), mRNA 
0.62   10  101  395  NM_079508.2  CG2534-RA, transcript variant A (cno), mRNA 
0.62   10  72  305  NM_132351.1  CG1343-RA, transcript variant A (Sp1), mRNA 
0.62   10  72  302  NM_167200.1  CG1343-RB, transcript variant B (Sp1), mRNA 
0.62   14  56  NM_170229.2  CG5099-RB, transcript variant B (msi), mRNA 
0.62   14  51  NM_079838.2  CG5099-RA, transcript variant A (msi), mRNA 
0.41   27  157  813  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0.41   26  462  2372  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0.41   26  462  2372  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0.41   26  462  2372  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0.41   25  116  409  NM_206089.1  CG33473-RB (luna), mRNA 
0.41   20  108  405  NM_078575.2  CG9355-RA (dy), mRNA 
0.41   15  192  953  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0.41   15  192  953  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0.41   13  74  316  NM_168412.1  CG32062-RD, transcript variant D (CG32062), mRNA 
0.41   13  74  316  NM_168413.1  CG32062-RB, transcript variant B (CG32062), mRNA 
0.41   12  86  377  NM_140939.2  CG17233-RB, transcript variant B (CG17233), mRNA 
0.41   12  86  377  NM_168837.1  CG17233-RC, transcript variant C (CG17233), mRNA 
0.41   12  83  462  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0.41   12  83  462  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0.41   12  75  353  NM_132041.2  CG15765-RA (CG15765), mRNA 
0.41   12  37  164  NM_080047.2  CG8491-RA (kto), mRNA 
0.41   12  37  111  NM_140669.2  CG9715-RA (CG9715), mRNA 
0.41   11  90  358  NM_001014576.1  CG7391-RD, transcript variant D (Clk), mRNA 
0.41   11  90  358  NM_001014575.1  CG7391-RE, transcript variant E (Clk), mRNA 
0.41   11  90  358  NM_001014574.1  CG7391-RF, transcript variant F (Clk), mRNA 
0.41   11  90  358  NM_079240.2  CG7391-RA, transcript variant A (Clk), mRNA 
0.41   11  90  358  NM_206299.1  CG7391-RC, transcript variant C (Clk), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.