National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3242R-2 
 Symbol sob  Full Name sister of odd and bowl 
 CG No CG3242  Old CG No CG3242 
 Synonyms org1, CG3242, sob 
 Accession No (Link to NCBI) NM_057534.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Buchon N, Osman D, David FP, Fang HY, Boquete JP, Deplancke B, Lemaitre B.
Morphological and molecular characterization of adult midgut compartmentalization in Drosophila.
Cell Rep (2013) 3(5) 1725-38 [ PubMed ID = 23643535 ] [ RRC reference ]

Bauke AC, Sasse S, Matzat T, Klämbt C.
A transcriptional network controlling glial development in the Drosophila visual system.
Development (2015) 142(12) 2184-93 [ PubMed ID = 26015542 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CACCGGCAGCAAGCAGCGATATTGCCGAGGCGCTTGGAGAACTCAAGGCAAGCGCAACAG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CAGCAGCATCATCAGCTAGCAAGGCAGCAACATCGAAGCACCACAGCAACAACAACCACA 120

                          ||||||||||||||| |||||||||||||||||||||  ||||||||||||||||||||| silico     121 AGCCAAGTGCCGCAGCAACAGCCACAGCAGCGCACAA--GAAAAGCGAGAGTTGCAACAG 180

                          ||||| | |||||||||||||||||||||||||||||||| ||| ||||||||||||| | silico     181 CAACGGC-AACAAGTGCACCGCTGCAACATCGCCGATCGGCAGT-AAGACCAGCAACGCA 240

                          ||||||| |||||||||||||||||||||||||||||||||||||||||||||| ||||| silico     241 GCCATGGCAGCTGCAACAGCAACGGCGGCCGCAGCAACCAACGATCTTGCAGCGGCTGCT 300

                          ||||||||||||||||||||||||||||||||||||||||| ||||||||   ||||||| silico     301 GCGGTCGTTCTTTCGCTGCAAGGAACCATGGTCAGCAGTTTGCAGCAGGC---CGCCCTA 360

                          ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| silico     361 CTGCCGGCCAATTCGGCGGCAGCAGCAGC-TCTTAATCTCCAGGCCCTGGAATCCTATTT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GGCGCTGCAGCGACTAACCGGGAAATCGGATGTATTTCGCTTTTCCAACAGCAACACCGG 480

                          |||||||||||||||||||||||||||| silico     481 CAGCAGCAACAGCAACAACGCCACCACC 508

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  14  98  NM_057534.3  CG3242-RA (sob), mRNA 
1.24   18  94  316  NM_142597.2  CG12254-RA (MED25), mRNA 
0.62   10  101  395  NM_169025.1  CG2534-RB, transcript variant B (cno), mRNA 
0.62   10  101  395  NM_079508.2  CG2534-RA, transcript variant A (cno), mRNA 
0.62   10  72  305  NM_132351.1  CG1343-RA, transcript variant A (Sp1), mRNA 
0.62   10  72  302  NM_167200.1  CG1343-RB, transcript variant B (Sp1), mRNA 
0.62   14  56  NM_170229.2  CG5099-RB, transcript variant B (msi), mRNA 
0.62   14  51  NM_079838.2  CG5099-RA, transcript variant A (msi), mRNA 
0.41   27  157  813  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0.41   26  462  2372  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0.41   26  462  2372  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0.41   26  462  2372  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0.41   25  116  409  NM_206089.1  CG33473-RB (luna), mRNA 
0.41   20  108  405  NM_078575.2  CG9355-RA (dy), mRNA 
0.41   15  192  953  NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
0.41   15  192  953  NM_166030.1  CG8118-RB, transcript variant B (mam), mRNA 
0.41   13  74  316  NM_168412.1  CG32062-RD, transcript variant D (CG32062), mRNA 
0.41   13  74  316  NM_168413.1  CG32062-RB, transcript variant B (CG32062), mRNA 
0.41   12  86  377  NM_140939.2  CG17233-RB, transcript variant B (CG17233), mRNA 
0.41   12  86  377  NM_168837.1  CG17233-RC, transcript variant C (CG17233), mRNA 
0.41   12  83  462  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0.41   12  83  462  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0.41   12  75  353  NM_132041.2  CG15765-RA (CG15765), mRNA 
0.41   12  37  164  NM_080047.2  CG8491-RA (kto), mRNA 
0.41   12  37  111  NM_140669.2  CG9715-RA (CG9715), mRNA 
0.41   11  90  358  NM_001014576.1  CG7391-RD, transcript variant D (Clk), mRNA 
0.41   11  90  358  NM_001014575.1  CG7391-RE, transcript variant E (Clk), mRNA 
0.41   11  90  358  NM_001014574.1  CG7391-RF, transcript variant F (Clk), mRNA 
0.41   11  90  358  NM_079240.2  CG7391-RA, transcript variant A (Clk), mRNA 
0.41   11  90  358  NM_206299.1  CG7391-RC, transcript variant C (Clk), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.