National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3229R-2 
 Symbol CG33123  Full Name CG33123 
 CG No CG33123  Old CG No CG3229 
 Synonyms CG3229, anon-EST:Posey266, CG33123 
 Accession No (Link to NCBI) NM_175954.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCTGGCCCTTCGGATTCCACT 
 Primer Seq. 3'
aatctagaggtaccATCGTGGTCCATGCACGGCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCTGGCCCTT CGGATTCCAC TGCACCGGCA TGCCCATCAA GGCTTGTGCG GACAAGTTAA 
0061 CGCGCGAACT GGAGCAGTTC GGCATTNTCC ACCACAGTTC CCCGAGACCG AGGAAGTGGT 
0121 CCCCGTTGCC GCAGAAGCCG CATCCGAGGT GCCCAAGGAC AAGTCCAAGG GAAAGAAGAG 
0181 CAAAGCGGTT GCCAAAACCG GCGCCTGCCA AATACCAATG GCAAATTATG CAGAGTCTCG 
0241 NCGACTGAAG NGACGNAGGA AATCAAGAGA CTTTGCCAAT GCCAGAACAC TGGCTTAACT 
0301 ACTTCCCACC GCTGGCGGTG CAGAGATCTC AAGCGGATCG GCGTGCACGT GGACTGGAGG 
0361 CGTACATTCA TCACCACGGA TGCCAATCCC TATTTCGACT CGTTCGTGCG CTGGCAGTTC 
0421 AACCACCTGA AGGAGCGGGG CAAGATCATG TACGGCAAGC GGTATACCAT ATATTCGCCC 
0481 AAGGATGGGC AGCCgTGCAT GGACCACGAT  
 in silico PCR Fragment
0001 TCTGGCCCTT CGGATTCCAC TGCACCGGCA TGCCCATCAA GGCTTGTGCG GACAAGTTAA 
0061 CGCGCGAACT GGAGCAGTTC GGC--TTTCC ACCACAGTTC CCCGAGACCG AGGAAGTGGT 
0121 CCCCGTTGCC GCAGAAGCCG CATCCGAGGT GCCCAAGGAC AAGTCCAAGG GAAAGAAGAG 
0181 CAAAGCGGTT GCCAAAACCG GCG-CTGCCA AATACCAATG GCAAATTATG CAGAGTCTCG 
0241 --GACTGAAG -GACG-AGGA AATCAAG-GA CTTTGCCAAT GCC-GAACAC TGGCTTAACT 
0301 ACTTCCCACC GCTGGCGGTG CAG-GATCTC AAGCGGATCG GCGTGCACGT GGACTGGAGG 
0361 CGTACATTCA TCACCACGGA TGCCAATCCC TATTTCGACT CGTTCGTGCG CTGGCAGTTC 
0421 AACCACCTGA AGGAGCGGGG CAAGATCATG TACGGCAAGC GGTATACCAT ATATTCGCCC 
0481 AAGGATGGGC AGCCGTGCAT GGACCACGAT  
 Assemble Data

3229R-2.IR_full       1   TCTGGCCCTTCGGATTCCACTGCACCGGCATGCCCATCAAGGCTTGTGCGGACAAGTTAA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3229R-2.in silico     1   TCTGGCCCTTCGGATTCCACTGCACCGGCATGCCCATCAAGGCTTGTGCGGACAAGTTAA 60


3229R-2.IR_full       61  CGCGCGAACTGGAGCAGTTCGGCATTNTCCACCACAGTTCCCCGAGACCGAGGAAGTGGT 120
                          |||||||||||||||||||||||  | |||||||||||||||||||||||||||||||||
3229R-2.in silico     61  CGCGCGAACTGGAGCAGTTCGGC--TTTCCACCACAGTTCCCCGAGACCGAGGAAGTGGT 120


3229R-2.IR_full       121 CCCCGTTGCCGCAGAAGCCGCATCCGAGGTGCCCAAGGACAAGTCCAAGGGAAAGAAGAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3229R-2.in silico     121 CCCCGTTGCCGCAGAAGCCGCATCCGAGGTGCCCAAGGACAAGTCCAAGGGAAAGAAGAG 180


3229R-2.IR_full       181 CAAAGCGGTTGCCAAAACCGGCGCCTGCCAAATACCAATGGCAAATTATGCAGAGTCTCG 240
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
3229R-2.in silico     181 CAAAGCGGTTGCCAAAACCGGCG-CTGCCAAATACCAATGGCAAATTATGCAGAGTCTCG 240


3229R-2.IR_full        241 CGACTGAAGNGACGNAGGAAATCAAGAGACTTTGCCAATGCCAGAACACTGGCTTAACT 299
                            |||||||| |||| ||||||||||| ||||||||||||||| ||||||||||||||||
3229R-2.in silico      241 -GACTGAAG-GACG-AGGAAATCAAG-GACTTTGCCAATGCC-GAACACTGGCTTAACT 299


3229R-2.IR_full       301 ACTTCCCACCGCTGGCGGTGCAGAGATCTCAAGCGGATCGGCGTGCACGTGGACTGGAGG 359
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
3229R-2.in silico     301 ACTTCCCACCGCTGGCGGTGCAG-GATCTCAAGCGGATCGGCGTGCACGTGGACTGGAGG 359


3229R-2.IR_full       361 CGTACATTCATCACCACGGATGCCAATCCCTATTTCGACTCGTTCGTGCGCTGGCAGTTC 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3229R-2.in silico     361 CGTACATTCATCACCACGGATGCCAATCCCTATTTCGACTCGTTCGTGCGCTGGCAGTTC 419


3229R-2.IR_full       421 AACCACCTGAAGGAGCGGGGCAAGATCATGTACGGCAAGCGGTATACCATATATTCGCCC 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3229R-2.in silico     421 AACCACCTGAAGGAGCGGGGCAAGATCATGTACGGCAAGCGGTATACCATATATTCGCCC 479


3229R-2.IR_full       481 AAGGATGGGCAGCCGTGCATGGACCACGAT 509
                          ||||||||||||||||||||||||||||||
3229R-2.in silico     481 AAGGATGGGCAGCCGTGCATGGACCACGAT 509

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_175954.1  CG33123-RA (CG33123), mRNA 
0   NM_132180.1  CG10920-RA (CG10920), mRNA 
0   NM_136111.2  CG10750-RA (CG10750), mRNA 
0   NM_166629.1  CG11184-RB, transcript variant B (Upf3), mRNA 
0   NM_138000.2  CG11184-RC, transcript variant C (Upf3), mRNA 
0   NM_135994.1  CG5043-RA (CG5043), mRNA 
0   NM_001043100.1  CG15661-RB, transcript variant B (CG15661), mRNA 
0   NM_137720.2  CG15661-RA, transcript variant A (CG15661), mRNA 
0   NM_206696.1  CG1522-RC, transcript variant C (cac), mRNA 
0   NM_078578.2  CG1522-RA, transcript variant A (cac), mRNA 
0   NM_001014734.1  CG1522-RH, transcript variant H (cac), mRNA 
0   NM_001014733.1  CG1522-RI, transcript variant I (cac), mRNA 
0   NM_206697.1  CG1522-RB, transcript variant B (cac), mRNA 
0   NM_206693.1  CG1522-RF, transcript variant F (cac), mRNA 
0   NM_001014732.1  CG1522-RJ, transcript variant J (cac), mRNA 
0   NM_001014735.1  CG1522-RG, transcript variant G (cac), mRNA 
0   NM_206695.1  CG1522-RD, transcript variant D (cac), mRNA 
0   NM_206694.1  CG1522-RE, transcript variant E (cac), mRNA 
0   NM_079700.1  CG3723-RA (Dhc93AB), mRNA 
0   NM_132538.1  CG15737-RA (CG15737), mRNA 
0   NM_135651.2  CG4751-RA (CG4751), mRNA 
0   NM_001032399.1  CG33955-RB (eys), mRNA 
0   NM_166163.1  CG8048-RC, transcript variant C (Vha44), mRNA 
0   NM_057918.3  CG8048-RA, transcript variant A (Vha44), mRNA 
0   NM_134313.2  CG8048-RB, transcript variant B (Vha44), mRNA 
0   NM_166164.2  CG8048-RD, transcript variant D (Vha44), mRNA 
0   NM_140868.1  CG14098-RB, transcript variant B (CG14098), mRNA 
0   NM_168803.1  CG14098-RA, transcript variant A (CG14098), mRNA 
0   NM_140821.2  CG3819-RA (CG3819), mRNA 
0   18  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.