National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 32120R-2 
 Symbol sens  Full Name senseless 
 CG No CG32120  Old CG No CG32120 
 Synonyms Sens, Sen, sense, Ly, CG10714, Ly-1, 1228/04, l(3)70Ad, CG32120, sens 
 Accession No (Link to NCBI) NM_080079.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Huang YC, Lu YN, Wu JT, Chien CT, Pi H.
The COP9 signalosome converts temporal hormone signaling to spatial restriction on neural competence.
PLoS Genet. (2014) 10(11) e1004760 [ PubMed ID = 25393278 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTACTCGAGTGCCCTACTGTG 
 Primer Seq. 3'
aatctagaggtaccTCTTCAGGCCGTACTGCTCCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTACTCGAGT GCCCTACTGT GGCCCCAATT TTTGTTGTCC TCGGCCACGG CTCTGGGTAC 
0061 ACCACTGACC CCCATGACCC CCAAATCGCC CGCCTCTGTG GTTTTGGGTC AGCGGGATCG 
0121 TGACTTTGCC TTGACGCCCG AAAAGGAGCA TGAACTCCAA ATGAACAATA ACAATGAGAA 
0181 CAGCAAGCAG GACTATCAGG AGCAGGATGA GGATATGCCA CTAAATCTAA GCACCAAGGA 
0241 GCGCATCACA TCGGATGATT CCAACCGAGA TCAGTATCAC AGCAGCAGCA ACAACAGCAG 
0301 CAGGAGCAGT TCCAGCAGTG AAGTGGAGCA ACTGCATCCG ATGACCTCGC TGAACGTTAC 
0361 CCCGCCTCCC CTGAGCGCTG TGAATCTAAA GAGTTCGAGT ACACCACAGC AACAGCGCCA 
0421 GAGATCGCAG GGTAACATCA TCTGGTCACC GGCCTCGATG TGCGAGAGAT CGGCGAGAAG 
0481 GGAGCAGTAC GGCCTGAAGA  
 in silico PCR Fragment
0001 CTACTCGAGT GCCCTACTGT GGCCCCAATT TTTGTTGTCC TCGGCCACGG CTCTGGGTAC 
0061 ACCACTGACC CCCATGACCC CCAAATCGCC CGCCTCTGTG GTTTTGGGTC AGCGGGATCG 
0121 TGACTTTGCC TTGACGCCCG AAAAGGAGCA TGAACTCCAA ATGAACAATA ACAATGAGAA 
0181 CAGCAAGCAG GACTATCAGG AGCAGGATGA GGATATGCCA CTAAATCTAA GCACCAAGGA 
0241 GCGCATCACA TCGGATGATT CCAACCGAGA TCAGTATCAC AGCAGCAGCA ACAACAGCAG 
0301 CAGGAGCAGT TCCAGCAGTG AAGTGGAGCA ACTGCATCCG ATGACCTCGC TGAACGTTAC 
0361 CCCGCCTCCC CTGAGCGCTG TGAATCTAAA GAGTTCGAGT ACACCACAGC AACAGCGCCA 
0421 GAGATCGCAG GGTAACATCA TCTGGTCACC GGCCTCGATG TGCGAGAGAT CGGCGAGAAG 
0481 GGAGCAGTAC GGCCTGAAGA  
 Assemble Data

32120R-2.IR_full       1   CTACTCGAGTGCCCTACTGTGGCCCCAATTTTTGTTGTCCTCGGCCACGGCTCTGGGTAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32120R-2.in silico     1   CTACTCGAGTGCCCTACTGTGGCCCCAATTTTTGTTGTCCTCGGCCACGGCTCTGGGTAC 60


32120R-2.IR_full       61  ACCACTGACCCCCATGACCCCCAAATCGCCCGCCTCTGTGGTTTTGGGTCAGCGGGATCG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32120R-2.in silico     61  ACCACTGACCCCCATGACCCCCAAATCGCCCGCCTCTGTGGTTTTGGGTCAGCGGGATCG 120


32120R-2.IR_full       121 TGACTTTGCCTTGACGCCCGAAAAGGAGCATGAACTCCAAATGAACAATAACAATGAGAA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32120R-2.in silico     121 TGACTTTGCCTTGACGCCCGAAAAGGAGCATGAACTCCAAATGAACAATAACAATGAGAA 180


32120R-2.IR_full       181 CAGCAAGCAGGACTATCAGGAGCAGGATGAGGATATGCCACTAAATCTAAGCACCAAGGA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32120R-2.in silico     181 CAGCAAGCAGGACTATCAGGAGCAGGATGAGGATATGCCACTAAATCTAAGCACCAAGGA 240


32120R-2.IR_full       241 GCGCATCACATCGGATGATTCCAACCGAGATCAGTATCACAGCAGCAGCAACAACAGCAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32120R-2.in silico     241 GCGCATCACATCGGATGATTCCAACCGAGATCAGTATCACAGCAGCAGCAACAACAGCAG 300


32120R-2.IR_full       301 CAGGAGCAGTTCCAGCAGTGAAGTGGAGCAACTGCATCCGATGACCTCGCTGAACGTTAC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32120R-2.in silico     301 CAGGAGCAGTTCCAGCAGTGAAGTGGAGCAACTGCATCCGATGACCTCGCTGAACGTTAC 360


32120R-2.IR_full       361 CCCGCCTCCCCTGAGCGCTGTGAATCTAAAGAGTTCGAGTACACCACAGCAACAGCGCCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32120R-2.in silico     361 CCCGCCTCCCCTGAGCGCTGTGAATCTAAAGAGTTCGAGTACACCACAGCAACAGCGCCA 420


32120R-2.IR_full       421 GAGATCGCAGGGTAACATCATCTGGTCACCGGCCTCGATGTGCGAGAGATCGGCGAGAAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
32120R-2.in silico     421 GAGATCGCAGGGTAACATCATCTGGTCACCGGCCTCGATGTGCGAGAGATCGGCGAGAAG 480


32120R-2.IR_full       481 GGAGCAGTACGGCCTGAAGA 500
                           ||||||||||||||||||||
32120R-2.in silico     481 GGAGCAGTACGGCCTGAAGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  23  59  NM_080079.2  CG32120-RA (sens), mRNA 
7.05   34  130  609  1278  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
7.05   34  130  609  1278  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
7.05   34  130  609  1278  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
4.56   22  37  123  168  NM_166992.2  CG2904-RA (ec), mRNA 
4.56   22  36  137  242  NM_169258.1  CG9755-RA, transcript variant A (pum), mRNA 
4.56   22  36  137  242  NM_169259.1  CG9755-RD, transcript variant D (pum), mRNA 
4.56   22  36  137  242  NM_079561.2  CG9755-RC, transcript variant C (pum), mRNA 
4.35   21  60  214  397  NM_135077.2  CG14023-RA (CG14023), mRNA 
3.94   19  38  130  242  NM_168179.1  CG32394-RA (CG32394), mRNA 
3.31   16  30  103  234  NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
3.31   16  30  103  234  NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
3.11   15  36  51  116  NM_132328.1  CG17446-RA (CG17446), mRNA 
3.11   15  34  121  165  NM_079939.2  CG5580-RA, transcript variant A (sbb), mRNA 
2.9   14  54  130  268  NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
2.9   14  54  116  227  NM_176241.1  CG10543-RC, transcript variant C (CG10543), mRNA 
2.9   14  54  116  227  NM_166416.1  CG10543-RB, transcript variant B (CG10543), mRNA 
2.9   14  39  123  331  NM_143409.1  CG11873-RA (CG11873), mRNA 
2.9   14  26  55  183  NM_132114.1  CG14442-RA (CG14442), mRNA 
2.9   14  36  56  NM_168353.1  CG32048-RB, transcript variant B (CG32048), mRNA 
2.9   14  36  56  NM_168352.1  CG32048-RA, transcript variant A (CG32048), mRNA 
2.69   13  79  165  364  NM_079903.2  CG15319-RB (nej), mRNA 
2.69   13  29  51  97  NM_140468.2  CG9425-RA, transcript variant A (CG9425), mRNA 
2.69   13  29  51  97  NM_206362.1  CG9425-RB, transcript variant B (CG9425), mRNA 
2.69   13  27  66  96  NM_079119.2  CG4354-RA (slbo), mRNA 
2.48   12  51  83  143  NM_080487.2  CG10572-RA (Cdk8), mRNA 
2.48   12  41  92  133  NM_132126.1  CG3075-RA (CG3075), mRNA 
2.48   12  18  36  62  NM_166667.1  CG3411-RA (bs), mRNA 
2.28   11  18  120  285  NM_079845.2  CG7951-RA (sima), mRNA 
2.28   11  30  41  NM_206285.1  CG32393-RB, transcript variant B (dikar), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.