National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31956R-2 
 Symbol pgant4  Full Name polypeptide GalNAc transferase 4 
 CG No CG31956  Old CG No CG31956 
 Synonyms CG31956, CG8845b, CG8845, pgant4 
 Accession No (Link to NCBI) NM_164539.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTCACCACTTTGGTGGTCGAA 
 Primer Seq. 3'
aatctagaggtaccAGGGTGTTAAAGTGCTCGTTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTCACCACTT TGGTgGTCGA ACGGCGAATG AAAAATGCGG CNGAGctGAC GGAACAACTC 
0061 GATCCGAATg GAGATCCCAT AACGCCCGTT TTTAGGGCTG CCAATATACA TCCAACTCGG 
0121 AAAGCGCCAC GACCACCATT TCAGGATCGC AACTCCGTGG TAGATATTCC GAGAAGTGAC 
0181 AAACTCCAGG GATTCCGACT ACCGGAACCG AAGGGAGAGC GCAAGGATTG GCACGACTAT 
0241 GCGGCCATGG AGGCGGATAG AAAGCGATCC GGTTTCGGTG AGCACGGAGT AGCCGTAAAG 
0301 ATCGAAAATC CCGATGAGAA GCAGTTGGAA AAGGAGCACT ACGAGATGAA CGGCTTTAAT 
0361 GGCCTCATAT CGGATAGAAT CTCCGTCAAT CGATCTGTGC CAGACCTCAG ACTCGAGGCT 
0421 TGCAAGACCC GGAAGTATCT GGCCAAGTTG CCCAATATCA GCGTGATTTT CATCTTCTTC 
0481 AACGAGCACT TTAACACCCT  
 in silico PCR Fragment
0001 GTCACCACTT TGGTGGTCGA ACGGCGAATG AAAAATGCGG CGGAGCTGAC GGAACAACTC 
0061 GATCCGAATG GAGATCCCAT AACGCCCGTT TTTAGGGCTG CCAATATACA TCCAACTCGG 
0121 AAAGCGCCAC GACCACCATT TCAGGATCGC AACTCCGTGG TAGATATTCC GAGAAGTGAC 
0181 AAACTCCAGG GATTCCGACT ACCGGAACCG AAGGGAGAGC GCAAGGATTG GCACGACTAT 
0241 GCGGCCATGG AGGCGGATAG AAAGCGATCC GGTTTCGGTG AGCACGGAGT AGCCGTAAAG 
0301 ATCGAAAATC CCGATGAGAA GCAGTTGGAA AAGGAGCACT ACGAGATGAA CGGCTTTAAT 
0361 GGCCTCATAT CGGATAGAAT CTCCGTCAAT CGATCTGTGC CAGACCTCAG ACTCGAGGCT 
0421 TGCAAGACCC GGAAGTATCT GGCCAAGTTG CCCAATATCA GCGTGATTTT CATCTTCTTC 
0481 AACGAGCACT TTAACACCCT  
 Assemble Data

31956R-2.IR_full        1   TCACCACTTTGGTGGTCGAACGGCGAATGAAAAATGCGGCNGAGCTGACGGAACAACTC 59
                            |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||
31956R-2.in silico      1   TCACCACTTTGGTGGTCGAACGGCGAATGAAAAATGCGGCGGAGCTGACGGAACAACTC 59


31956R-2.IR_full       61  GATCCGAATGGAGATCCCATAACGCCCGTTTTTAGGGCTGCCAATATACATCCAACTCGG 119
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31956R-2.in silico     61  GATCCGAATGGAGATCCCATAACGCCCGTTTTTAGGGCTGCCAATATACATCCAACTCGG 119


31956R-2.IR_full       121 AAAGCGCCACGACCACCATTTCAGGATCGCAACTCCGTGGTAGATATTCCGAGAAGTGAC 179
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31956R-2.in silico     121 AAAGCGCCACGACCACCATTTCAGGATCGCAACTCCGTGGTAGATATTCCGAGAAGTGAC 179


31956R-2.IR_full       181 AAACTCCAGGGATTCCGACTACCGGAACCGAAGGGAGAGCGCAAGGATTGGCACGACTAT 239
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31956R-2.in silico     181 AAACTCCAGGGATTCCGACTACCGGAACCGAAGGGAGAGCGCAAGGATTGGCACGACTAT 239


31956R-2.IR_full       241 GCGGCCATGGAGGCGGATAGAAAGCGATCCGGTTTCGGTGAGCACGGAGTAGCCGTAAAG 299
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31956R-2.in silico     241 GCGGCCATGGAGGCGGATAGAAAGCGATCCGGTTTCGGTGAGCACGGAGTAGCCGTAAAG 299


31956R-2.IR_full       301 ATCGAAAATCCCGATGAGAAGCAGTTGGAAAAGGAGCACTACGAGATGAACGGCTTTAAT 359
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31956R-2.in silico     301 ATCGAAAATCCCGATGAGAAGCAGTTGGAAAAGGAGCACTACGAGATGAACGGCTTTAAT 359


31956R-2.IR_full       361 GGCCTCATATCGGATAGAATCTCCGTCAATCGATCTGTGCCAGACCTCAGACTCGAGGCT 419
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31956R-2.in silico     361 GGCCTCATATCGGATAGAATCTCCGTCAATCGATCTGTGCCAGACCTCAGACTCGAGGCT 419


31956R-2.IR_full       421 TGCAAGACCCGGAAGTATCTGGCCAAGTTGCCCAATATCAGCGTGATTTTCATCTTCTTC 479
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31956R-2.in silico     421 TGCAAGACCCGGAAGTATCTGGCCAAGTTGCCCAATATCAGCGTGATTTTCATCTTCTTC 479


31956R-2.IR_full       481 AACGAGCACTTTAACACCCT 499
                           ||||||||||||||||||||
31956R-2.in silico     481 AACGAGCACTTTAACACCCT 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_164539.1  CG31956-RA (pgant4), mRNA 
0   NM_057257.3  CG7664-RA (crp), mRNA 
0   NM_169095.1  CG1093-RB, transcript variant B (plx), mRNA 
0   NM_169094.1  CG1093-RA, transcript variant A (plx), mRNA 
0   NM_140836.1  CG14082-RA (CG14082), mRNA 
0   NM_167436.1  CG6170-RB, transcript variant B (HDAC6), mRNA 
0   NM_132789.2  CG6170-RA, transcript variant A (HDAC6), mRNA 
0   NM_167437.1  CG6170-RC, transcript variant C (HDAC6), mRNA 
0   NM_130616.2  CG4290-RA (CG4290), mRNA 
0   NM_079754.2  CG5695-RA, transcript variant A (jar), mRNA 
0   NM_001014650.1  CG5695-RC, transcript variant C (jar), mRNA 
0   NM_170138.1  CG5695-RB, transcript variant B (jar), mRNA 
0   NM_001014647.1  CG5695-RF, transcript variant F (jar), mRNA 
0   NM_001014648.1  CG5695-RE, transcript variant E (jar), mRNA 
0   NM_001014649.1  CG5695-RD, transcript variant D (jar), mRNA 
0   NM_135914.1  CG15253-RA (CG15253), mRNA 
0   NM_132660.2  CG1716-RA (CG1716), mRNA 
0   NM_134682.2  CG4133-RA (CG4133), mRNA 
0   NM_001043010.1  CG9432-RD, transcript variant D (l(2)01289), mRNA 
0   NM_165485.1  CG9432-RB, transcript variant B (l(2)01289), mRNA 
0   NM_133158.2  CG12204-RA (CG12204), mRNA 
0   NM_166059.1  CG30076-RA (CG30076), mRNA 
0   NM_205997.1  CG15270-RB, transcript variant B (CG15270), mRNA 
0   NM_135894.2  CG15270-RA, transcript variant A (CG15270), mRNA 
0   21  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_137199.2  CG8182-RA, transcript variant A (GalNAc-T1), mRNA 
0   NM_166099.1  CG8182-RB, transcript variant B (GalNAc-T1), mRNA 
0   NM_206710.1  CG1372-RB, transcript variant B (yl), mRNA 
0   NM_078596.2  CG1372-RA, transcript variant A (yl), mRNA 
0   NM_165913.1  CG8581-RB, transcript variant B (fra), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.