National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3194R-1 
 Symbol CG3194  Full Name CG3194 
 CG No CG3194  Old CG No CG3194 
 Synonyms CG3194 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCAGCGGAGGAGAAGCTACAGCGCTGCACGACATTGAGTGCTCCATTAACCAGGAGTACA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCGTGCACTGCAAGCGAGACGAGAACGCCAACGAGGTTTACGTTCCGTTTTCCTTCCTGC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GTAACTACTTCGACGTCAGTGGAGCAGTTTCCACCAACAGCAATGAGGTGGCCAAGTTCA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ACTGGGTGCACAGCACAGCCAAAGTTAACCTTCCCAGGGGAAAGTACGATGCGCGCGGCG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TCTATATGTACTTTGAGAACTACAACGTGGAAGTGCGCGACCGGGTAAAGTGCATCAGTG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CCGCGGAGGGCGTTCCAGTGAGCACGCAATGGGAGAAGCGTGGGTACTTTTACCCCACAC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AAATTGCCCAGTTCGCGTTGTCGCACTACAGCAAGAACCTCACAGAGCCGGCACCCAGGG 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TTCGCGTGTTGGAGGACGGCGACGGGAACCAGATGGAATGGAGTACGCCCAAGACCAGCA 480

3194R-1.IR full       481 ACATGACCCGCATCTGGCAC 500
                          |||||||||||||||||||| silico     481 ACATGACCCGCATCTGGCAC 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_136405.2  CG3194-RA (CG3194), mRNA 
NM_079920.2  gomdanji CG6727-RA (gom), mRNA 
NM_137625.1  CG16868-RA (CG16868), mRNA 
NM_169003.2  CG31522-RA, transcript variant A (CG31522), mRNA 
NM_169002.2  CG31522-RD, transcript variant D (CG31522), mRNA 
NM_169001.2  CG31522-RB, transcript variant B (CG31522), mRNA 
10  NM_079811.2  Ets at 98B CG5583-RA (Ets98B), mRNA 
NM_080153.3  atypical protein kinase C CG10261-RA, transcript variant A (aPKC), mRNA 
NM_001043076.1  atypical protein kinase C CG10261-RC, transcript variant C (aPKC), mRNA 
NM_001043080.1  atypical protein kinase C CG10261-RD, transcript variant D (aPKC), mRNA 
NM_001043078.1  atypical protein kinase C CG10261-RE, transcript variant E (aPKC), mRNA 
NM_001043079.1  atypical protein kinase C CG10261-RB, transcript variant B (aPKC), mRNA 
NM_001043077.1  atypical protein kinase C CG10261-RF, transcript variant F (aPKC), mRNA 
NM_140427.1  endosulfine CG6513-RA, transcript variant A (endos), mRNA 
NM_168572.1  endosulfine CG6513-RB, transcript variant B (endos), mRNA 
NM_168346.1  CG32043-RB, transcript variant B (CG32043), mRNA 
NM_140064.2  CG32043-RA, transcript variant A (CG32043), mRNA 
NM_130576.2  CG3740-RA (CG3740), mRNA 
NM_139722.2  CG10590-RA (CG10590), mRNA 
NM_130478.2  CG2995-RA (CG2995), mRNA 
NM_078608.3  CNG channel-like CG9176-RC, transcript variant C (cngl), mRNA 
NM_143225.2  CG6490-RA (CG6490), mRNA 
NM_167441.2  CNG channel-like CG9176-RB, transcript variant B (cngl), mRNA 
NM_139361.1  CG12090-RB, transcript variant B (CG12090), mRNA 
NM_166543.1  roundabout CG13521-RB, transcript variant B (robo), mRNA 
NM_057551.3  roundabout CG13521-RA, transcript variant A (robo), mRNA 
NM_057250.3  shuttle craft CG3647-RA, transcript variant A (stc), mRNA 
NM_205987.1  CG32972-RA, transcript variant A (CG32972), mRNA 
NM_057251.3  shuttle craft CG3647-RB, transcript variant B (stc), mRNA 
NM_079205.3  Dynein heavy chain 64C CG7507-RA, transcript variant A (Dhc64C), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.