National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31916R-1 
 Symbol Msp-300  Full Name Muscle-specific protein 300 
 CG No CG33715  Old CG No CG31916 
 Synonyms FBgn0010070, MSP-300, CG18252, MSP300, jf22, CG31649, BcDNA:AT10293, BcDNA:GH18470, l(2)jf22, l(2)25Ch, Spec25CD, CG18251, BcDNA:LP10936, BcDNA:GH02446, CG31916, CG33549, CG33715, Msp-300, Muscle-specific protein 300, lethal(2)25Ch, nesprin, Nesprin, repetitive ORF, msp-300 
 Accession No (Link to NCBI) NM_001032052.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Junion G, Bataillé L, Jagla T, Da Ponte JP, Tapin R, Jagla K.
Genome-wide view of cell fate specification: ladybird acts at multiple levels during diversification of muscle and heart precursors.
Genes Dev. (2007) 21(23) 3163-80 [ PubMed ID = 18056427 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCAAGTCTACGATGCGACCGCT 
 Primer Seq. 3'
aatctagaggtaccCGCTCGCTTTCGATGAACTGG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CAAGTCTACG ATGCGACCgC TCGAAAGTCC TATGCGCTGG ATCCCCATTC AGTGGTGACC 
0061 ACTTCATCGA CTGTCTCGTT GCTTATGAAG CCAACGGCGG CAGTAGGTCT AACCTATGCT 
0121 GAAGTGCTGT CGGGACAAGC GAGTCCGGTA AGCAGCGGTA ATGAATCGGT AACCAATTCC 
0181 CGACCAGAAC GAGACCCCTC CACGACGACA ACAACAACGA CAACACGGCA GCAACAATCG 
0241 AACGATACTC AGAACACGAC CACTATTACA ACCATTAAGA CTACCACAAC TACGACAACG 
0301 ACTTCGAGAA GTACGCACGG CGATGATGAT CAAAGCCAGG AGAGACAAGA GCTCAATGGC 
0361 GGTGGCAGCA CCACAGCCAC AGCAAACTAT AAGCGCCCCC AACAGGTCAT ACCACCCAGC 
0421 GAGAATACCT CAAACACGGT TCCTAACACA GCTACGACAA CGATAACCAA TCCCAATATC 
0481 CAGTTCATCG AAATGCGAGC G 
 in silico PCR Fragment
0001 CAAGTCTACG ATGCGACCGC TCGAAAGTCC TATGCGCTGG ATCCCCATTC AGTGGTGACC 
0061 ACTTCATCGA CTGTCTCGTT GCTTATGAAG CCAACGGCGG CAGTAGGTCT AACCTATGCT 
0121 GAAGTGCTGT CGGGACAAGC GAGTCCGGTA AGCAGCGGTA ATGAATCGGT AACCAATTCC 
0181 CGACCAGAAC GAGACCCCTC CACGACGACA ACAACAACGA CAACACGGCA GCAACAATCG 
0241 AACGATACTC AGAACACGAC CACTATTACA ACCATTAAGA CTACCACAAC TACGACAACG 
0301 ACTTCGAGAA GTACGCACGG CGATGATGAT CAAAGCCAGG AGAGACAAGA GCTCAATGGC 
0361 GGTGGCAGCA CCACAGCCAC AGCAAACTAT AAGCGCCCCC AACAGGTCAC ACCACCCAGC 
0421 GAGAATACCT CAAACACGGT TCCTAACACA GCTACGACAA CGATAACCAA TCCCAATATC 
0481 CAGTTCATCG AAA-GCGAGC G 
 Assemble Data

31916R-1.IR_full       1   CAAGTCTACGATGCGACCGCTCGAAAGTCCTATGCGCTGGATCCCCATTCAGTGGTGACC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31916R-1.in silico     1   CAAGTCTACGATGCGACCGCTCGAAAGTCCTATGCGCTGGATCCCCATTCAGTGGTGACC 60


31916R-1.IR_full       61  ACTTCATCGACTGTCTCGTTGCTTATGAAGCCAACGGCGGCAGTAGGTCTAACCTATGCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31916R-1.in silico     61  ACTTCATCGACTGTCTCGTTGCTTATGAAGCCAACGGCGGCAGTAGGTCTAACCTATGCT 120


31916R-1.IR_full       121 GAAGTGCTGTCGGGACAAGCGAGTCCGGTAAGCAGCGGTAATGAATCGGTAACCAATTCC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31916R-1.in silico     121 GAAGTGCTGTCGGGACAAGCGAGTCCGGTAAGCAGCGGTAATGAATCGGTAACCAATTCC 180


31916R-1.IR_full       181 CGACCAGAACGAGACCCCTCCACGACGACAACAACAACGACAACACGGCAGCAACAATCG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31916R-1.in silico     181 CGACCAGAACGAGACCCCTCCACGACGACAACAACAACGACAACACGGCAGCAACAATCG 240


31916R-1.IR_full       241 AACGATACTCAGAACACGACCACTATTACAACCATTAAGACTACCACAACTACGACAACG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31916R-1.in silico     241 AACGATACTCAGAACACGACCACTATTACAACCATTAAGACTACCACAACTACGACAACG 300


31916R-1.IR_full       301 ACTTCGAGAAGTACGCACGGCGATGATGATCAAAGCCAGGAGAGACAAGAGCTCAATGGC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31916R-1.in silico     301 ACTTCGAGAAGTACGCACGGCGATGATGATCAAAGCCAGGAGAGACAAGAGCTCAATGGC 360


31916R-1.IR_full       361 GGTGGCAGCACCACAGCCACAGCAAACTATAAGCGCCCCCAACAGGTCATACCACCCAGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||
31916R-1.in silico     361 GGTGGCAGCACCACAGCCACAGCAAACTATAAGCGCCCCCAACAGGTCACACCACCCAGC 420


31916R-1.IR_full       421 GAGAATACCTCAAACACGGTTCCTAACACAGCTACGACAACGATAACCAATCCCAATATC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31916R-1.in silico     421 GAGAATACCTCAAACACGGTTCCTAACACAGCTACGACAACGATAACCAATCCCAATATC 480


31916R-1.IR_full       481 CAGTTCATCGAAATGCGAGCG 501
                           ||||||||||||| |||||||
31916R-1.in silico     481 CAGTTCATCGAAA-GCGAGCG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  13  137  NM_001032052.1  CG33715-RE, transcript variant E (Msp-300), mRNA 
0.41   47  NM_166242.1  CG10936-RB, transcript variant B (CG10936), mRNA 
0.41   47  NM_137395.1  CG10936-RA, transcript variant A (CG10936), mRNA 
0.2   26  NM_080110.2  CG32356-RA, transcript variant A (ImpE1), mRNA 
0.2   36  91  NM_136854.1  CG13194-RA (pyr), mRNA 
0.2   NM_167392.1  CG32614-RA (CG32614), mRNA 
0   16  39  NM_001014642.1  CG33518-RA (mun), mRNA 
0   21  NM_130571.1  CG14796-RA (CG14796), mRNA 
0   12  NM_141132.1  CG14460-RA (CG14460), mRNA 
0   10  24  NM_165676.1  CG11804-RB, transcript variant B (ced-6), mRNA 
0   11  30  NM_132967.1  CG5004-RA (CG5004), mRNA 
0   20  NM_136344.1  CG14470-RA (CG14470), mRNA 
0   25  NM_168343.1  CG3743-RB, transcript variant B (MTF-1), mRNA 
0   25  NM_140054.2  CG3743-RA, transcript variant A (MTF-1), mRNA 
0   13  NM_141594.1  CG11970-RA (CG11970), mRNA 
0   34  98  NM_142162.2  CG6912-RA (CG6912), mRNA 
0   18  46  NM_079001.2  CG3886-RA (Psc), mRNA 
0   12  18  NM_168218.1  CG32372-RA (CG32372), mRNA 
0   21  NM_142210.1  CG6118-RA (CG6118), mRNA 
0   16  NM_166153.1  CG8448-RB, transcript variant B (mrj), mRNA 
0   13  NM_139656.1  CG13720-RA (CG13720), mRNA 
0   15  NM_079055.2  CG4943-RA (lack), mRNA 
0   18  21  NM_144273.1  CG15036-RA (CG15036), mRNA 
0   21  NM_132577.1  CG2556-RA (CG2556), mRNA 
0   18  NM_079300.2  CG11720-RA (Sgs3), mRNA 
0   35  NM_057811.3  CG3373-RA (Hmu), mRNA 
0   25  NM_166840.1  CG3777-RA, transcript variant A (CG3777), mRNA 
0   25  NM_166841.1  CG3777-RC, transcript variant C (CG3777), mRNA 
0   25  NM_130483.2  CG3777-RB, transcript variant B (CG3777), mRNA 
0   19  NM_143087.1  CG13652-RA (CG13652), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.