National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 4 May to 11 May, deadline 21 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31872R-2 
 Symbol CG31872  Full Name CG31872 
 CG No CG31872  Old CG No CG31872 
 Synonyms CG17101, CG17093, CG31872 
 Accession No (Link to NCBI) NM_164937.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem Biophys Res Commun (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS One (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||| silico     1   AATCGTTTAGCCGAGGGCTTGAAGAAGCGAAGCTTCAAATCCAAAAGCAATCTCAATCAC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  AATCGCAGGCTCAAGGTCTAGGTCAATCACAGCAACAAATCCAATACGCGAATATAGCCA 120

                           |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| silico     121 GAACTAAAGTCCAAAAACAATTCCAATCGCAACAACTAGGACTGGCTCAATCGCAGCAAC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 AGACCCAGATTCAACAATCACTGAATCAAGATGGAGCTAAATTACGAGAAAAACCTTATC 240

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| silico     241 CGCATATTCAAACTTCATCACAAAGAAACGCCGATGATCCAGAAAGTGAAGAAGCTGAAG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CACCAGGAGGACTGTCGGGAAAAATAGCTTTAGTACCACCAAATGAAGAGGGAGATCAAA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AGCAAGACCAGGCTCAATCACAGATTGAAGATGAAGCTGAAGTTCTTAGACAAGGTCTGG 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CGCAAACGGAATCTCAAATTCAGAATCAAAGACAAGGACTGGAAAAGGAGATACAAGGGC 480

31872R-2.IR_full       481 AATCCCAATCGCAGGATCAA 500
                           |||||||||||||||||||| silico     481 AATCCCAATCGCAGGATCAA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  18  98  NM_164937.1  CG31872-RA (CG31872), mRNA 
0.2   NM_140674.2  CG11915-RA (CG11915), mRNA 
0   NM_165176.2  CG31782-RB, transcript variant B (CG31782), mRNA 
0   NM_165175.1  CG31782-RA, transcript variant A (CG31782), mRNA 
0   NM_079088.2  CG9952-RA (ppa), mRNA 
0   NM_206153.1  CG33130-RC, transcript variant C (l(2)k07433), mRNA 
0   NM_176218.1  CG33130-RA, transcript variant A (l(2)k07433), mRNA 
0   NM_206154.1  CG33130-RB, transcript variant B (l(2)k07433), mRNA 
0   NM_169845.1  CG31043-RA, transcript variant A (gukh), mRNA 
0   NM_001032021.1  CG31043-RC, transcript variant C (gukh), mRNA 
0   NM_169846.1  CG31043-RB, transcript variant B (gukh), mRNA 
0   NM_137961.2  CG17280-RA (CG17280), mRNA 
0   NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_143141.2  CG4548-RB, transcript variant B (XNP), mRNA 
0   NM_170228.1  CG4548-RA, transcript variant A (XNP), mRNA 
0   NM_176107.1  CG33199-RA, transcript variant A (CG33199), mRNA 
0   NM_136588.2  CG8229-RC, transcript variant C (CG8229), mRNA 
0   NM_141657.2  CG8273-RA (CG8273), mRNA 
0   NM_135570.3  CG6144-RA, transcript variant A (CG6144), mRNA 
0   NM_001038806.1  CG6144-RB, transcript variant B (CG6144), mRNA 
0   NM_078527.2  CG2151-RA, transcript variant A (Trxr-1), mRNA 
0   NM_167149.1  CG2151-RB, transcript variant B (Trxr-1), mRNA 
0   NM_167150.1  CG2151-RC, transcript variant C (Trxr-1), mRNA 
0   NM_167151.1  CG32715-RA (CG32715), mRNA 
0   13  227  NM_167482.3  CG32580-RA (CG32580), mRNA 
0   11  NM_132912.1  CG4521-RA (mthl1), mRNA 
0   24  NM_131978.1  CG15465-RA (CG15465), mRNA 
0   15  NM_206362.1  CG9425-RB, transcript variant B (CG9425), mRNA 
0   15  NM_140468.2  CG9425-RA, transcript variant A (CG9425), mRNA 
0   NM_080103.2  CG1922-RA (onecut), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.