National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31872R-2 
 Symbol CG31872  Full Name CG31872 
 CG No CG31872  Old CG No CG31872 
 Synonyms CG17101, CG17093, CG31872 
 Accession No (Link to NCBI) NM_164937.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem. Biophys. Res. Commun. (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAATCGTTTAGCCGAGGGCTTG 
 Primer Seq. 3'
aatctagaggtaccTTGATCCTGCGATTGGGATTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AATCGTTTAG CCGAgGGCTT GAAGAAGCNA agcNTCAAAT CCAAAAGCAA TCTCAATCAC 
0061 AATCGCAGGC TCAAGGTCTA GGTCAATCAC AGCAACAAAT CCAATACGCG AATATAGCCA 
0121 GAACTAAAGT CCAAAAACAA TTCCAATCGC AAGAACTAGG ACTGGCTCAA TCGCAGCAAC 
0181 AGACCCAGAT TCAACAATCA CTGAATCAAG ATGGAGCTAA ATTACGAGAA AAACCTTATC 
0241 CGCATATTCA AACTTCATCA CAAAGAAACG CCGATGATCC AGAAAGTGAA GAATCTGAAG 
0301 CACCAGGAGG ACTGTCGGGA AAAATAGCTT TAGTACCACC AAATGAAGAG GGAGATCAAA 
0361 AGCAAGACCA GGCTCAATCA CAGATTGAAG ATGAAGCTGA AGTTCTTAGA CAAGGTCTGG 
0421 CGCAAACGGA ATCTCAAATT CAGAATCAAA GACAAGGACT GGAAAAGGAG ATACAAGGGC 
0481 AATCCCAATC GCAGGATCAA  
 in silico PCR Fragment
0001 AATCGTTTAG CCGAGGGCTT GAAGAAGCGA AGCTTCAAAT CCAAAAGCAA TCTCAATCAC 
0061 AATCGCAGGC TCAAGGTCTA GGTCAATCAC AGCAACAAAT CCAATACGCG AATATAGCCA 
0121 GAACTAAAGT CCAAAAACAA TTCCAATCGC AACAACTAGG ACTGGCTCAA TCGCAGCAAC 
0181 AGACCCAGAT TCAACAATCA CTGAATCAAG ATGGAGCTAA ATTACGAGAA AAACCTTATC 
0241 CGCATATTCA AACTTCATCA CAAAGAAACG CCGATGATCC AGAAAGTGAA GAAGCTGAAG 
0301 CACCAGGAGG ACTGTCGGGA AAAATAGCTT TAGTACCACC AAATGAAGAG GGAGATCAAA 
0361 AGCAAGACCA GGCTCAATCA CAGATTGAAG ATGAAGCTGA AGTTCTTAGA CAAGGTCTGG 
0421 CGCAAACGGA ATCTCAAATT CAGAATCAAA GACAAGGACT GGAAAAGGAG ATACAAGGGC 
0481 AATCCCAATC GCAGGATCAA  
 Assemble Data

31872R-2.IR_full       1   AATCGTTTAGCCGAGGGCTTGAAGAAGCNAAGCNTCAAATCCAAAAGCAATCTCAATCAC 60
                           |||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||
31872R-2.in silico     1   AATCGTTTAGCCGAGGGCTTGAAGAAGCGAAGCTTCAAATCCAAAAGCAATCTCAATCAC 60


31872R-2.IR_full       61  AATCGCAGGCTCAAGGTCTAGGTCAATCACAGCAACAAATCCAATACGCGAATATAGCCA 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31872R-2.in silico     61  AATCGCAGGCTCAAGGTCTAGGTCAATCACAGCAACAAATCCAATACGCGAATATAGCCA 120


31872R-2.IR_full       121 GAACTAAAGTCCAAAAACAATTCCAATCGCAAGAACTAGGACTGGCTCAATCGCAGCAAC 180
                           |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
31872R-2.in silico     121 GAACTAAAGTCCAAAAACAATTCCAATCGCAACAACTAGGACTGGCTCAATCGCAGCAAC 180


31872R-2.IR_full       181 AGACCCAGATTCAACAATCACTGAATCAAGATGGAGCTAAATTACGAGAAAAACCTTATC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31872R-2.in silico     181 AGACCCAGATTCAACAATCACTGAATCAAGATGGAGCTAAATTACGAGAAAAACCTTATC 240


31872R-2.IR_full       241 CGCATATTCAAACTTCATCACAAAGAAACGCCGATGATCCAGAAAGTGAAGAATCTGAAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
31872R-2.in silico     241 CGCATATTCAAACTTCATCACAAAGAAACGCCGATGATCCAGAAAGTGAAGAAGCTGAAG 300


31872R-2.IR_full       301 CACCAGGAGGACTGTCGGGAAAAATAGCTTTAGTACCACCAAATGAAGAGGGAGATCAAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31872R-2.in silico     301 CACCAGGAGGACTGTCGGGAAAAATAGCTTTAGTACCACCAAATGAAGAGGGAGATCAAA 360


31872R-2.IR_full       361 AGCAAGACCAGGCTCAATCACAGATTGAAGATGAAGCTGAAGTTCTTAGACAAGGTCTGG 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31872R-2.in silico     361 AGCAAGACCAGGCTCAATCACAGATTGAAGATGAAGCTGAAGTTCTTAGACAAGGTCTGG 420


31872R-2.IR_full       421 CGCAAACGGAATCTCAAATTCAGAATCAAAGACAAGGACTGGAAAAGGAGATACAAGGGC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31872R-2.in silico     421 CGCAAACGGAATCTCAAATTCAGAATCAAAGACAAGGACTGGAAAAGGAGATACAAGGGC 480


31872R-2.IR_full       481 AATCCCAATCGCAGGATCAA 500
                           ||||||||||||||||||||
31872R-2.in silico     481 AATCCCAATCGCAGGATCAA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  18  98  NM_164937.1  CG31872-RA (CG31872), mRNA 
0.2   NM_140674.2  CG11915-RA (CG11915), mRNA 
0   NM_165176.2  CG31782-RB, transcript variant B (CG31782), mRNA 
0   NM_165175.1  CG31782-RA, transcript variant A (CG31782), mRNA 
0   NM_079088.2  CG9952-RA (ppa), mRNA 
0   NM_206153.1  CG33130-RC, transcript variant C (l(2)k07433), mRNA 
0   NM_176218.1  CG33130-RA, transcript variant A (l(2)k07433), mRNA 
0   NM_206154.1  CG33130-RB, transcript variant B (l(2)k07433), mRNA 
0   NM_169845.1  CG31043-RA, transcript variant A (gukh), mRNA 
0   NM_001032021.1  CG31043-RC, transcript variant C (gukh), mRNA 
0   NM_169846.1  CG31043-RB, transcript variant B (gukh), mRNA 
0   NM_137961.2  CG17280-RA (CG17280), mRNA 
0   NM_141666.2  CG9492-RA (CG9492), mRNA 
0   NM_143141.2  CG4548-RB, transcript variant B (XNP), mRNA 
0   NM_170228.1  CG4548-RA, transcript variant A (XNP), mRNA 
0   NM_176107.1  CG33199-RA, transcript variant A (CG33199), mRNA 
0   NM_136588.2  CG8229-RC, transcript variant C (CG8229), mRNA 
0   NM_141657.2  CG8273-RA (CG8273), mRNA 
0   NM_135570.3  CG6144-RA, transcript variant A (CG6144), mRNA 
0   NM_001038806.1  CG6144-RB, transcript variant B (CG6144), mRNA 
0   NM_078527.2  CG2151-RA, transcript variant A (Trxr-1), mRNA 
0   NM_167149.1  CG2151-RB, transcript variant B (Trxr-1), mRNA 
0   NM_167150.1  CG2151-RC, transcript variant C (Trxr-1), mRNA 
0   NM_167151.1  CG32715-RA (CG32715), mRNA 
0   13  227  NM_167482.3  CG32580-RA (CG32580), mRNA 
0   11  NM_132912.1  CG4521-RA (mthl1), mRNA 
0   24  NM_131978.1  CG15465-RA (CG15465), mRNA 
0   15  NM_206362.1  CG9425-RB, transcript variant B (CG9425), mRNA 
0   15  NM_140468.2  CG9425-RA, transcript variant A (CG9425), mRNA 
0   NM_080103.2  CG1922-RA (onecut), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.