National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31849R-1 
 Symbol CG31849  Full Name CG31849 
 CG No CG31849  Old CG No CG31849 
 Synonyms BcDNA:LD34806, CG31849 
 Accession No (Link to NCBI) NM_165027.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCACATTCCTGGCCACCTACA 
 Primer Seq. 3'
aatctagaggtaccATCTCTGCCGTGCCAGCCACT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCACATTCCT GGCCACCTAC AACCAGACAC CGGTAGCCGG CGTTGGACGG CTGGCCATCA 
0061 CCAAGAAGCT GGTGCTCTGG TTGGTGCTGG TGCTGCAGGT GGGCTTCATC GGCTGCATAT 
0121 GGCTGCTGCA GATGAGCCGT GGCCAGGAGT CGCAGCAGCG CAGTGCAATG GACCAACTTG 
0181 GCGGACGGGT CAACTTCGTG GCCAGCGGTG AAGCCCCNTA TGGAGAAGAT GGCACTTGTG 
0241 GGCGGAACCC ACTGTCCGCA TCTGCAGGAG AATGTCAACC GCTACGACAA GGACTTTTAT 
0301 CAAATGAAAC CGGAACGACT GAACGAATCC CACCTGCCCG ACTACAATGT GCCCGCCTAT 
0361 GTGGACGCGG AGATGGGTCT AACCCCAAAc CTCTgGNGCT NTCGCGAGGG GACCATCAAC 
0421 GAGAgCCAGC GGCTCAACGA TGTGGACTAT CTGATggNGC CGCCTCAATG CAGATGTGAA 
0481 AGTGGCTGGC ACGGCAGAGA T 
 in silico PCR Fragment
0001 GCACATTCCT GGCCACCTAC AACCAGACAC CGGTAGCCGG CGTTGGACGG CTGGCCATCA 
0061 CCAAGAAGCT GGTGCTCTGG TTGGTGCTGG TGCTGCAGGT GGGCTTCATC GGCTGCATAT 
0121 GGCTGCTGCA GATGAGCCGT GGCCAGGAGT CGCAGCAGCG CAGTGCAATG GACCAACTTG 
0181 GCGGACGGGT CAACTTCGTG GCCAGCGGTG AAGCCCC-TA TGGAGAAGAT GGCACTTGTG 
0241 GGCGGAACCC ACTGTCCGCA TCTGCAGGAG AATGTCAACC GCTACGACAA GGACTTTTAT 
0301 CAAATGAAAC CGGAACGACT GAACGAATCC CACCTGCCCG ACTACAATGT GCCCGCCTAT 
0361 GTGGACGCGG AGATGGGTCT AACCCCAAAC CTCTGGTGCT ATCGCGAGGG GACCATCAAC 
0421 GAGAGCCAGC GGCTCAACGA TGTGGACTAT CTGATGGCGC CGCCTCAATG CAGATGTGAA 
0481 AGTGGCTGGC ACGGCAGAGA T 
 Assemble Data

31849R-1.IR_full       1   GCACATTCCTGGCCACCTACAACCAGACACCGGTAGCCGGCGTTGGACGGCTGGCCATCA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31849R-1.in silico     1   GCACATTCCTGGCCACCTACAACCAGACACCGGTAGCCGGCGTTGGACGGCTGGCCATCA 60


31849R-1.IR_full       61  CCAAGAAGCTGGTGCTCTGGTTGGTGCTGGTGCTGCAGGTGGGCTTCATCGGCTGCATAT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31849R-1.in silico     61  CCAAGAAGCTGGTGCTCTGGTTGGTGCTGGTGCTGCAGGTGGGCTTCATCGGCTGCATAT 120


31849R-1.IR_full       121 GGCTGCTGCAGATGAGCCGTGGCCAGGAGTCGCAGCAGCGCAGTGCAATGGACCAACTTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31849R-1.in silico     121 GGCTGCTGCAGATGAGCCGTGGCCAGGAGTCGCAGCAGCGCAGTGCAATGGACCAACTTG 180


31849R-1.IR_full       181 GCGGACGGGTCAACTTCGTGGCCAGCGGTGAAGCCCCNTATGGAGAAGATGGCACTTGTG 240
                           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
31849R-1.in silico     181 GCGGACGGGTCAACTTCGTGGCCAGCGGTGAAGCCCC-TATGGAGAAGATGGCACTTGTG 240


31849R-1.IR_full       241 GGCGGAACCCACTGTCCGCATCTGCAGGAGAATGTCAACCGCTACGACAAGGACTTTTAT 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31849R-1.in silico     241 GGCGGAACCCACTGTCCGCATCTGCAGGAGAATGTCAACCGCTACGACAAGGACTTTTAT 300


31849R-1.IR_full       301 CAAATGAAACCGGAACGACTGAACGAATCCCACCTGCCCGACTACAATGTGCCCGCCTAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31849R-1.in silico     301 CAAATGAAACCGGAACGACTGAACGAATCCCACCTGCCCGACTACAATGTGCCCGCCTAT 360


31849R-1.IR_full       361 GTGGACGCGGAGATGGGTCTAACCCCAAACCTCTGGNGCTNTCGCGAGGGGACCATCAAC 420
                           |||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||
31849R-1.in silico     361 GTGGACGCGGAGATGGGTCTAACCCCAAACCTCTGGTGCTATCGCGAGGGGACCATCAAC 420


31849R-1.IR_full       421 GAGAGCCAGCGGCTCAACGATGTGGACTATCTGATGGNGCCGCCTCAATGCAGATGTGAA 480
                           ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||
31849R-1.in silico     421 GAGAGCCAGCGGCTCAACGATGTGGACTATCTGATGGCGCCGCCTCAATGCAGATGTGAA 480


31849R-1.IR_full       481 AGTGGCTGGCACGGCAGAGAT 501
                           |||||||||||||||||||||
31849R-1.in silico     481 AGTGGCTGGCACGGCAGAGAT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165027.1  CG31849-RA (CG31849), mRNA 
0.2   NM_079728.4  CG31289-RA (Dph5), mRNA 
0   NM_137352.3  CG17290-RA (CG17290), mRNA 
0   17  NM_079507.2  CG2530-RA (corto), mRNA 
0   NM_170660.1  CG32508-RA, transcript variant A (shakB), mRNA 
0   NM_170661.1  CG32508-RB, transcript variant B (shakB), mRNA 
0   NM_170132.1  CG31137-RD, transcript variant D (twin), mRNA 
0   NM_133100.1  CG7095-RA (CG7095), mRNA 
0   NM_001043152.1  CG8363-RF, transcript variant F (Paps), mRNA 
0   NM_168823.2  CG8363-RC, transcript variant C (Paps), mRNA 
0   NM_168821.2  CG8363-RA, transcript variant A (Paps), mRNA 
0   NM_168822.2  CG8363-RB, transcript variant B (Paps), mRNA 
0   NM_168824.2  CG8363-RD, transcript variant D (Paps), mRNA 
0   NM_079447.3  CG8363-RE, transcript variant E (Paps), mRNA 
0   NM_132979.1  CG10597-RA (CG10597), mRNA 
0   11  NM_057506.2  CG7672-RA, transcript variant A (gl), mRNA 
0   11  NM_169807.2  CG7672-RB, transcript variant B (gl), mRNA 
0   NM_166961.1  CG32498-RI, transcript variant I (dnc), mRNA 
0   NM_166965.1  CG32498-RJ, transcript variant J (dnc), mRNA 
0   NM_166963.1  CG32498-RK, transcript variant K (dnc), mRNA 
0   NM_166964.1  CG32498-RD, transcript variant D (dnc), mRNA 
0   NM_166962.1  CG32498-RC, transcript variant C (dnc), mRNA 
0   NM_166967.1  CG32498-RA, transcript variant A (dnc), mRNA 
0   NM_166966.1  CG32498-RM, transcript variant M (dnc), mRNA 
0   NM_166959.1  CG32498-RO, transcript variant O (dnc), mRNA 
0   NM_166960.1  CG32498-RB, transcript variant B (dnc), mRNA 
0   NM_166970.1  CG32498-RG, transcript variant G (dnc), mRNA 
0   NM_166968.1  CG32498-RN, transcript variant N (dnc), mRNA 
0   NM_166971.1  CG32498-RL, transcript variant L (dnc), mRNA 
0   NM_080322.2  CG32498-RF, transcript variant F (dnc), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.