National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3181R-1 
 Symbol Ts  Full Name Ts 
 CG No CG3181  Old CG No CG3181 
 Synonyms CG3181, FBgn0024920, TS, c1.5, anon-23Ca, Ts 
 Accession No (Link to NCBI) NM_058019.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Lindström R, Lindholm P, Palgi M, Saarma M, Heino TI.
In vivo screening reveals interactions between Drosophila Manf and genes involved in the mitochondria and the ubiquinone synthesis pathway.
BMC Genet (2017) 18(1) 52 [ PubMed ID = 28578657 ] [ RRC reference ]

Álvarez-Fernández C, Tamirisa S, Prada F, Chernomoretz A, Podhajcer O, Blanco E, Martín-Blanco E.
Identification and functional analysis of healing regulators in Drosophila.
PLoS Genet (2015) 11(2) e1004965 [ PubMed ID = 25647511 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS One (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, Dürrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGACAATGGGGAGTCACCAAG 
 Primer Seq. 3'
aatctagaggtaccACATGATGATGCGACGGTCTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGACAATGGG GAGTCACCAA GTAAACAGCA GGCCCCTGTC AATCGGGATG AGATGCACTA 
0061 CTTGGATCTT CTGAGGCACA TCATCGCAAA TGGAGAGCAG CGGATGGACC GCACGGAGGT 
0121 GGGCACTCTG TCCGTGTTCG GCAGTCAGAT GCGCTTCGAC ATGCGGAACT CCTTTCCTTT 
0181 GCTGACCACG AAGCGCGTCT TCTTNCCGCG CGGTGGCCGA GGAGCTGCTG TGGTTCGTGG 
0241 CGGGCAAGAC GGACGCCAAG CTGCTGCAGG CGAAGAATGT GCACATCTGG GATGGGAACA 
0301 GCTCCAGAGA ATTCCTGGAC AAGATGGGGT TCACGGGGCG AGCCGTTGGG GATCTGGGGC 
0361 CGGTGTACGG CTTCCAATGG AGGCATTTCG GGGCGCAGTA CGGCACCTGC GACGACGACT 
0421 ACAGCGGCAA GGGGATCGAC CAGCTGCGCC AGGTGATTGA AACCATCAGG AATAACCCCT 
0481 CAGACCGTCG CATCATCATG T 
 in silico PCR Fragment
0001 CGACAATGGG GAGTCACCAA GTAAACAGCA GGCCCCTGTC AATCGGGATG AGATGCACTA 
0061 CTTGGATCTT CTGAGGCACA TCATCGCAAA TGGAGAGCAG CGGATGGACC GCACGGAGGT 
0121 GGGCACTCTG TCCGTGTTCG GCAGTCAGAT GCGCTTCGAC ATGCGGAACT CCTTTCCTTT 
0181 GCTGACCACG AAGCGCGTCT TCTT-CCGCG CGGTGGCCGA GGAGCTGCTG TGGTTCGTGG 
0241 CGGGCAAGAC GGACGCCAAG CTGCTGCAGG CGAAGAATGT GCACATCTGG GATGGGAACA 
0301 GCTCCAGAGA ATTTCTGGAC AAGATGGGGT TCACGGGGCG AGCCGTTGGG GATCTGGGGC 
0361 CGGTGTACGG CTTCCAATGG AGGCATTTCG GGGCGCAGTA CGGCACCTGC GACGACGACT 
0421 ACAGCGGCAA GGGGATCGAC CAGCTGCGCC AGGTGATCGA CACCATCAGG AATAACCCCT 
0481 CAGACCGTCG CATCATCATG T 
 Assemble Data

3181R-1.IR_full       1   CGACAATGGGGAGTCACCAAGTAAACAGCAGGCCCCTGTCAATCGGGATGAGATGCACTA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3181R-1.in silico     1   CGACAATGGGGAGTCACCAAGTAAACAGCAGGCCCCTGTCAATCGGGATGAGATGCACTA 60


3181R-1.IR_full       61  CTTGGATCTTCTGAGGCACATCATCGCAAATGGAGAGCAGCGGATGGACCGCACGGAGGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3181R-1.in silico     61  CTTGGATCTTCTGAGGCACATCATCGCAAATGGAGAGCAGCGGATGGACCGCACGGAGGT 120


3181R-1.IR_full       121 GGGCACTCTGTCCGTGTTCGGCAGTCAGATGCGCTTCGACATGCGGAACTCCTTTCCTTT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3181R-1.in silico     121 GGGCACTCTGTCCGTGTTCGGCAGTCAGATGCGCTTCGACATGCGGAACTCCTTTCCTTT 180


3181R-1.IR_full       181 GCTGACCACGAAGCGCGTCTTCTTNCCGCGCGGTGGCCGAGGAGCTGCTGTGGTTCGTGG 240
                          |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||
3181R-1.in silico     181 GCTGACCACGAAGCGCGTCTTCTT-CCGCGCGGTGGCCGAGGAGCTGCTGTGGTTCGTGG 240


3181R-1.IR_full       241 CGGGCAAGACGGACGCCAAGCTGCTGCAGGCGAAGAATGTGCACATCTGGGATGGGAACA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3181R-1.in silico     241 CGGGCAAGACGGACGCCAAGCTGCTGCAGGCGAAGAATGTGCACATCTGGGATGGGAACA 300


3181R-1.IR_full       301 GCTCCAGAGAATTCCTGGACAAGATGGGGTTCACGGGGCGAGCCGTTGGGGATCTGGGGC 360
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
3181R-1.in silico     301 GCTCCAGAGAATTTCTGGACAAGATGGGGTTCACGGGGCGAGCCGTTGGGGATCTGGGGC 360


3181R-1.IR_full       361 CGGTGTACGGCTTCCAATGGAGGCATTTCGGGGCGCAGTACGGCACCTGCGACGACGACT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3181R-1.in silico     361 CGGTGTACGGCTTCCAATGGAGGCATTTCGGGGCGCAGTACGGCACCTGCGACGACGACT 420


3181R-1.IR_full       421 ACAGCGGCAAGGGGATCGACCAGCTGCGCCAGGTGATTGAAACCATCAGGAATAACCCCT 480
                          ||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||
3181R-1.in silico     421 ACAGCGGCAAGGGGATCGACCAGCTGCGCCAGGTGATCGACACCATCAGGAATAACCCCT 480


3181R-1.IR_full       481 CAGACCGTCGCATCATCATGT 501
                          |||||||||||||||||||||
3181R-1.in silico     481 CAGACCGTCGCATCATCATGT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_058019.3  CG3181-RA (Ts), mRNA 
0   NM_170455.1  CG7908-RA, transcript variant A (Tace), mRNA 
0   NM_143502.2  CG7908-RB, transcript variant B (Tace), mRNA 
0   NM_136347.1  CG14471-RB, transcript variant B (CG14471), mRNA 
0   NM_176013.1  CG33114-RA (Gyc32E), mRNA 
0   NM_130507.2  CG7359-RA (CG7359), mRNA 
0   NM_132430.2  CG11207-RA (feo), mRNA 
0   NM_137385.1  CG18432-RA (CG18432), mRNA 
0   NM_141887.1  CG3532-RA (CG3532), mRNA 
0   NM_165144.1  CG4824-RB, transcript variant B (BicC), mRNA 
0   NM_001014727.1  CG12154-RB, transcript variant B (oc), mRNA 
0   NM_078536.3  CG12154-RA, transcript variant A (oc), mRNA 
0   NM_165538.1  CG1600-RA, transcript variant A (CG1600), mRNA 
0   NM_136449.2  CG1600-RC, transcript variant C (CG1600), mRNA 
0   NM_165539.1  CG1600-RB, transcript variant B (CG1600), mRNA 
0   NM_169868.1  CG31220-RA (CG31220), mRNA 
0   NM_170468.1  CG31029-RA (CG31029), mRNA 
0   NM_135043.2  CG3782-RA (mRpL28), mRNA 
0   NM_080054.2  CG1560-RA (mys), mRNA 
0   12  NM_167402.1  CG1517-RC, transcript variant C (na), mRNA 
0   12  NM_058026.3  CG5709-RA (ari-2), mRNA 
0   12  NM_167401.1  CG1517-RB, transcript variant B (na), mRNA 
0   NM_206229.1  CG9097-RA, transcript variant A (bab1), mRNA 
0   NM_167852.1  CG9097-RB, transcript variant B (bab1), mRNA 
0   NM_057645.2  CG10844-RC, transcript variant C (Rya-r44F), mRNA 
0   NM_057644.2  CG10844-RB, transcript variant B (Rya-r44F), mRNA 
0   NM_057646.2  CG10844-RD, transcript variant D (Rya-r44F), mRNA 
0   NM_057643.2  CG10844-RA, transcript variant A (Rya-r44F), mRNA 
0   NM_166292.1  CG30116-RA, transcript variant A (CG30116), mRNA 
0   NM_137493.2  CG30116-RC, transcript variant C (CG30116), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
++ 
DC
++ 
DM
 
VM
 
VB
 
Caspase-3 signal
N
DB
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.