National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31755R-1 
 Symbol CG31755  Full Name CG31755 
 CG No CG31755  Old CG No CG31755 
 Synonyms CG5831, CG31755 
 Accession No (Link to NCBI) NM_135491.2 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yang Z, Chen KM, Pandey RR, Homolka D, Reuter M, Janeiro BK, Sachidanandam R, Fauvarque MO, McCarthy AA, Pillai RS.
PIWI Slicing and EXD1 Drive Biogenesis of Nuclear piRNAs from Cytosolic Targets of the Mouse piRNA Pathway.
Mol. Cell (2016) 61(1) 138-52 [ PubMed ID = 26669262 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACAGGTTTACGTGGAGGATGA 
 Primer Seq. 3'
aatctagaggtaccTATCGATCGCCATGTCGTTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 ACAGGTNTTA CGTGGAGGAT GAGAGAGTTA TTGNTGCGCT ACCAGCGATG GAGTCCACCC 
0061 AAGCTCGTGA GAGGTGTGGT GCGCAGGCGG CAGAACGAGG AGTACCTGGT CTGGATCCTG 
0121 GATTACGGAT TTAACCTCTG CTGTTCTGTG TGGGATTTGT GGCCGCTGCC TGACCATTTG 
0181 AGTCGCAGTT TATGCGACTT TAAAGAGGGT GGTGTGGCCT TGATTGCTCC GCATTCTGGC 
0241 AGTGTCTGGT CCCGATCCGC CATTGAGTCC TTGGACAAAC AGCTAGAGGA TGCCAATCAG 
0301 CTCACATTTC AAGTCGTACA TCGTGGCAAA TCGAATCGGA ATTTCGGGCT GCTTAAGTTC 
0361 AGATCATCAT GCCAGACTGA GGATGCTGCA AACTTTCTAA TAAAGCAGGA CCAAGGACGC 
0421 TGCAAGGAAA CCTTAACCAT GGCCATCCCT TACGAGGATA TAAGCTTTGA AAAGGCTGAG 
0481 ATCAACGACA TGGCGATCGA TA 
 in silico PCR Fragment
0001 ACAGGT-TTA CGTGGAGGAT GAGAGAGTTA TTG-TGCGCT ACCAGCGATG GAGTCCACCC 
0061 AAGCTCGTGA GGGGTGTGGT GCGCAGGCGG CAGAACGAGG AGTACCTGGT CTGGATCCTG 
0121 GATTACGGAT TTAACCTCTG CTGTTCTGTG TGGGATTTGT GGCCGCTGCC TGACCATTTG 
0181 AGTCGCAGTT TATGCGACTT TAAAGAGGGT GGTGTGGCCT TGATTGCTCC GCATTCTGGC 
0241 AGTGTCTGGT CCCGATCCGC CATTGAGTCC TTGGACAAAC AGCTAGAGGA TGCCAATCAG 
0301 CTCACATTTC AAGTCGTACA TCGTGGCAAA TCGAATCGGA ATTTCGGGCT GCTTAAGTTC 
0361 AGATCATCAT GCCAGACTGA GGATGCTGCA AACTTTCTAA TAAAGCAGGA CCAAGGACGC 
0421 TGCAAGGAAA CCTTAACCAT GGCCATCCCT TACGAGGATA TAAGCTTTGA AAAGGCTGAG 
0481 ATCAACGACA TGGCGATCGA TA 
 Assemble Data

31755R-1.IR_full       1   ACAGGTNTTACGTGGAGGATGAGAGAGTTATTGNTGCGCTACCAGCGATGGAGTCCACCC 60
                           |||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||||
31755R-1.in silico     1   ACAGGT-TTACGTGGAGGATGAGAGAGTTATTG-TGCGCTACCAGCGATGGAGTCCACCC 60


31755R-1.IR_full       61  AAGCTCGTGAGAGGTGTGGTGCGCAGGCGGCAGAACGAGGAGTACCTGGTCTGGATCCTG 120
                           ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||
31755R-1.in silico     61  AAGCTCGTGAGGGGTGTGGTGCGCAGGCGGCAGAACGAGGAGTACCTGGTCTGGATCCTG 120


31755R-1.IR_full       121 GATTACGGATTTAACCTCTGCTGTTCTGTGTGGGATTTGTGGCCGCTGCCTGACCATTTG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31755R-1.in silico     121 GATTACGGATTTAACCTCTGCTGTTCTGTGTGGGATTTGTGGCCGCTGCCTGACCATTTG 180


31755R-1.IR_full       181 AGTCGCAGTTTATGCGACTTTAAAGAGGGTGGTGTGGCCTTGATTGCTCCGCATTCTGGC 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31755R-1.in silico     181 AGTCGCAGTTTATGCGACTTTAAAGAGGGTGGTGTGGCCTTGATTGCTCCGCATTCTGGC 240


31755R-1.IR_full       241 AGTGTCTGGTCCCGATCCGCCATTGAGTCCTTGGACAAACAGCTAGAGGATGCCAATCAG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31755R-1.in silico     241 AGTGTCTGGTCCCGATCCGCCATTGAGTCCTTGGACAAACAGCTAGAGGATGCCAATCAG 300


31755R-1.IR_full       301 CTCACATTTCAAGTCGTACATCGTGGCAAATCGAATCGGAATTTCGGGCTGCTTAAGTTC 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31755R-1.in silico     301 CTCACATTTCAAGTCGTACATCGTGGCAAATCGAATCGGAATTTCGGGCTGCTTAAGTTC 360


31755R-1.IR_full       361 AGATCATCATGCCAGACTGAGGATGCTGCAAACTTTCTAATAAAGCAGGACCAAGGACGC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31755R-1.in silico     361 AGATCATCATGCCAGACTGAGGATGCTGCAAACTTTCTAATAAAGCAGGACCAAGGACGC 420


31755R-1.IR_full       421 TGCAAGGAAACCTTAACCATGGCCATCCCTTACGAGGATATAAGCTTTGAAAAGGCTGAG 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31755R-1.in silico     421 TGCAAGGAAACCTTAACCATGGCCATCCCTTACGAGGATATAAGCTTTGAAAAGGCTGAG 480


31755R-1.IR_full       481 ATCAACGACATGGCGATCGATA 502
                           ||||||||||||||||||||||
31755R-1.in silico     481 ATCAACGACATGGCGATCGATA 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_135491.2  CG31755-RA (CG31755), mRNA 
0   NM_138065.1  CG3419-RA, transcript variant A (CG3419), mRNA 
0   NM_206215.1  CG3419-RB, transcript variant B (CG3419), mRNA 
0   NM_137833.1  CG4610-RA (CG4610), mRNA 
0   NM_134673.2  CG11912-RA (CG11912), mRNA 
0   NM_001043095.1  CG15078-RB, transcript variant B (Mctp), mRNA 
0   NM_057632.3  CG10072-RA (sgl), mRNA 
0   12  NM_134714.3  CG4341-RA (CG4341), mRNA 
0   10  NM_144448.2  CG1915-RC, transcript variant C (sls), mRNA 
0   NM_132488.3  CG11727-RB, transcript variant B (CG11727), mRNA 
0   NM_167285.2  CG11727-RA, transcript variant A (CG11727), mRNA 
0   NM_079937.2  CG1915-RA, transcript variant A (sls), mRNA 
0   NM_078661.3  CG8649-RA, transcript variant A (Fim), mRNA 
0   NM_142643.1  CG15923-RA (CG15923), mRNA 
0   NM_078981.2  CG8967-RA (otk), mRNA 
0   NM_137515.1  CG15072-RA (CG15072), mRNA 
0   NM_058023.4  CG4900-RA (Irp-1A), mRNA 
0   16  NM_132953.1  CG13001-RA (CG13001), mRNA 
0   NM_176130.3  CG12052-RJ, transcript variant J (lola), mRNA 
0   NM_132545.2  CG1806-RA (CG1806), mRNA 
0   NM_131936.2  CG3556-RA (CG3556), mRNA 
0   NM_079756.2  CG6383-RA, transcript variant A (crb), mRNA 
0   NM_001043286.1  CG6383-RB, transcript variant B (crb), mRNA 
0   NM_139413.2  CG12024-RA, transcript variant A (CG12024), mRNA 
0   NM_167921.1  CG12024-RB, transcript variant B (CG12024), mRNA 
0   NM_165377.1  CG8663-RB, transcript variant B (nrv3), mRNA 
0   NM_136264.4  CG8663-RA, transcript variant A (nrv3), mRNA 
0   NM_165378.1  CG8663-RC, transcript variant C (nrv3), mRNA 
0   NM_165379.1  CG8663-RD, transcript variant D (nrv3), mRNA 
0   NM_164442.1  CG31664-RA (CG31664), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.