National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31651R-3 
 Symbol pgant5  Full Name polypeptide GalNAc transferase 5 
 CG No CG31651  Old CG No CG31651 
 Synonyms CG31651, CG9152, l(2)e02157, pgant5 
 Accession No (Link to NCBI) NM_135062.3 
 Inserted Chr. ll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTTCTCGACATTCACACGCAA 
 Primer Seq. 3'
aatctagaggtaccGCGAGCGATTCAACGAAATCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTTCTCGACA TTCACACGCA AAATGCGCGG gcGCAGTGCG CTCCAACACC TGCCGCATCG 
0061 TCCTGCTCAC CTCGCTCGTT TGGGTGATCT TTGACTTCGT GCTCATCGCC CGCTACTCGG 
0121 ACTGCATCGG CAAGGATGGC TGGCGATGCA AGCGTTCCGG GGAATACGAC GTGGAGCTGC 
0181 CCAATGCCGA GCGTCTGGTG GACGACAATC AGCTGGTGGA CGATAATGAG ATAAATACGG 
0241 AAAAGTCACT CGATGGCGAA TCGGGTGGTG CTCTGATCAT GGGCCAAGGC TTTgCCTCGG 
0301 GCGGCATCTC GATGACCTAT CCCAGTGTGG TGCTTAAGAA GTGGTTCCTG GCgCCAAGCG 
0361 TGCAGGAAGc CAAGGGCAAA CCGGGCGAGA TgGGCAAGCC GGTTAAAATA CCCGCCGATA 
0421 TGAAGGATCT CATGAAGGAG AAGTTCAAGG AGAACCAGTT CAATCTGCTG GCCAGTGACA 
0481 TGATTTCGTT GAATCGCTCG C 
 in silico PCR Fragment
0001 CTTCTCGACA TTCACACGCA AAATGCGCGG GCGCA-TGCG CTCCAACACC TGCCGCATCG 
0061 TCCTGCTCAC CTCGCTCGTT TGGGTGATCT TTGACTTCGT GCTCATCGCC CGCTACTCGG 
0121 ACTGCATCGG CAAGGATGGC TGGCGATGCA AGCGTTCCGG GGAATACGAC GTGGAGCTGC 
0181 CCAATGCCGA GCGTCTGGTG GACGACAATC AGCTGGTGGA CGATAATGAG ATAAATACGG 
0241 AAAAGTCACT CGATGGCGAA TCGGGTGGTG CTCTGATCAT GGGCCAAGGC TTTGCCTCGG 
0301 GCGGCATCTC GATGACCTAT CCCAGTGTGG TGCTTAAGAA GTGGTTCCTG GCGCCAAGCG 
0361 TGCAGGAAGC CAAGGGCAAA CCGGGCGAGA TGGGCAAGCC GGTTAAAATA CCCGCCGATA 
0421 TGAAGGATCT CATGAAGGAG AAGTTCAAGG AGAACCAGTT CAATCTGCTG GCCAGTGACA 
0481 TGATTTCGTT GAATCGCTCG C 
 Assemble Data

31651R-3.IR_full       1   CTTCTCGACATTCACACGCAAAATGCGCGGGCGCAGTGCGCTCCAACACCTGCCGCATCG 60
                           ||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||
31651R-3.in silico     1   CTTCTCGACATTCACACGCAAAATGCGCGGGCGCA-TGCGCTCCAACACCTGCCGCATCG 60


31651R-3.IR_full       61  TCCTGCTCACCTCGCTCGTTTGGGTGATCTTTGACTTCGTGCTCATCGCCCGCTACTCGG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31651R-3.in silico     61  TCCTGCTCACCTCGCTCGTTTGGGTGATCTTTGACTTCGTGCTCATCGCCCGCTACTCGG 120


31651R-3.IR_full       121 ACTGCATCGGCAAGGATGGCTGGCGATGCAAGCGTTCCGGGGAATACGACGTGGAGCTGC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31651R-3.in silico     121 ACTGCATCGGCAAGGATGGCTGGCGATGCAAGCGTTCCGGGGAATACGACGTGGAGCTGC 180


31651R-3.IR_full       181 CCAATGCCGAGCGTCTGGTGGACGACAATCAGCTGGTGGACGATAATGAGATAAATACGG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31651R-3.in silico     181 CCAATGCCGAGCGTCTGGTGGACGACAATCAGCTGGTGGACGATAATGAGATAAATACGG 240


31651R-3.IR_full       241 AAAAGTCACTCGATGGCGAATCGGGTGGTGCTCTGATCATGGGCCAAGGCTTTGCCTCGG 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31651R-3.in silico     241 AAAAGTCACTCGATGGCGAATCGGGTGGTGCTCTGATCATGGGCCAAGGCTTTGCCTCGG 300


31651R-3.IR_full       301 GCGGCATCTCGATGACCTATCCCAGTGTGGTGCTTAAGAAGTGGTTCCTGGCGCCAAGCG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31651R-3.in silico     301 GCGGCATCTCGATGACCTATCCCAGTGTGGTGCTTAAGAAGTGGTTCCTGGCGCCAAGCG 360


31651R-3.IR_full       361 TGCAGGAAGCCAAGGGCAAACCGGGCGAGATGGGCAAGCCGGTTAAAATACCCGCCGATA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31651R-3.in silico     361 TGCAGGAAGCCAAGGGCAAACCGGGCGAGATGGGCAAGCCGGTTAAAATACCCGCCGATA 420


31651R-3.IR_full       421 TGAAGGATCTCATGAAGGAGAAGTTCAAGGAGAACCAGTTCAATCTGCTGGCCAGTGACA 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31651R-3.in silico     421 TGAAGGATCTCATGAAGGAGAAGTTCAAGGAGAACCAGTTCAATCTGCTGGCCAGTGACA 480


31651R-3.IR_full       481 TGATTTCGTTGAATCGCTCGC 501
                           |||||||||||||||||||||
31651R-3.in silico     481 TGATTTCGTTGAATCGCTCGC 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001042873.1  CG31651-RB, transcript variant B (pgant5), mRNA 
100   482  NM_135062.3  CG31651-RA, transcript variant A (pgant5), mRNA 
0   NM_176223.2  CG30115-RD, transcript variant D (CG30115), mRNA 
0   NM_137499.2  CG30115-RC, transcript variant C (CG30115), mRNA 
0   10  NM_141830.2  CG6790-RA (CG6790), mRNA 
0   NM_078799.2  CG3779-RA, transcript variant A (numb), mRNA 
0   NM_164855.1  CG3779-RB, transcript variant B (numb), mRNA 
0   NM_142060.3  CG9286-RA (CG9286), mRNA 
0   33  NM_132522.2  CG32662-RA (CG32662), mRNA 
0   NM_164564.1  CG31957-RA (CG31957), mRNA 
0   NM_141965.1  CG14395-RA (CG14395), mRNA 
0   NM_140645.1  CG13033-RA (CG13033), mRNA 
0   NM_057737.2  CG15804-RA, transcript variant A (Dhc62B), mRNA 
0   NM_206236.1  CG15804-RB, transcript variant B (Dhc62B), mRNA 
0   NM_176293.1  CG33171-RC, transcript variant C (CG33171), mRNA 
0   NM_176294.2  CG33171-RE, transcript variant E (CG33171), mRNA 
0   NM_137427.2  CG5036-RA (CG5036), mRNA 
0   NM_167128.1  CG32719-RA (CG32719), mRNA 
0   NM_139478.1  CG1143-RA (CG1143), mRNA 
0   NM_170502.1  CG2239-RC, transcript variant C (jdp), mRNA 
0   NM_170501.1  CG2239-RB, transcript variant B (jdp), mRNA 
0   NM_143550.2  CG2239-RA, transcript variant A (jdp), mRNA 
0   NM_141852.1  CG12594-RA (CG12594), mRNA 
0   11  NM_140759.2  CG5546-RA (MED19), mRNA 
0   NM_135935.2  CG12455-RA, transcript variant A (CG12455), mRNA 
0   NM_165149.1  CG12455-RB, transcript variant B (CG12455), mRNA 
0   NM_134668.1  CG17078-RA (CG17078), mRNA 
0   NM_141774.2  CG4596-RA (CG4596), mRNA 
0   NM_141324.1  CG1098-RA (Madm), mRNA 
0   NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.