National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31651R-2 
 Symbol pgant5  Full Name polypeptide GalNAc transferase 5 
 CG No CG31651  Old CG No CG31651 
 Synonyms CG31651, CG9152, l(2)e02157, pgant5 
 Accession No (Link to NCBI) NM_135062.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]

Saj A, Arziman Z, Stempfle D, van Belle W, Sauder U, Horn T, D├╝rrenberger M, Paro R, Boutros M, Merdes G.
A combined ex vivo and in vivo RNAi screen for notch regulators in Drosophila reveals an extensive notch interaction network.
Dev. Cell (2010) 18(5) 862-76 [ PubMed ID = 20493818 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| silico     1   CTTCTCGACATTCACACGCAAAATGCGCGGGCGCA-TGCGCTCCAACACCTGCCGCATCG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TCCTGCTCACCTCGCTCGTTTGGGTGATCTTTGACTTCGTGCTCATCGCCCGCTACTCGG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACTGCATCGGCAAGGATGGCTGGCGATGCAAGCGTTCCGGGGAATACGACGTGGAGCTGC 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CCAATGCCGAGCGTCTGGTGGACGACAATCAGCTGGTGGACGATAATGAGATAAATACGG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AAAAGTCACTCGATGGCGAATCGGGTGGTGCTCTGATCATGGGCCAAGGCTTTGCCTCGG 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GCGGCATCTCGATGACCTATCCCAGTGTGGTGCTTAAGAAGTGGTTCCTGGCGCCAAGCG 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TGCAGGAAGCCAAGGGCAAACCGGGCGAGATGGGCAAGCCGGTTAAAATACCCGCCGATA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 TGAAGGATCTCATGAAGGAGAAGTTCAAGGAGAACCAGTTCAATCTGCTGGCCAGTGACA 480

31651R-2.IR_full       481 TGATTTCGTTGAATCGCTCGC 501
                           ||||||||||||||||||||| silico     481 TGATTTCGTTGAATCGCTCGC 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001042873.1  CG31651-RB, transcript variant B (pgant5), mRNA 
100   482  NM_135062.3  CG31651-RA, transcript variant A (pgant5), mRNA 
0   NM_176223.2  CG30115-RD, transcript variant D (CG30115), mRNA 
0   NM_137499.2  CG30115-RC, transcript variant C (CG30115), mRNA 
0   10  NM_141830.2  CG6790-RA (CG6790), mRNA 
0   NM_078799.2  CG3779-RA, transcript variant A (numb), mRNA 
0   NM_164855.1  CG3779-RB, transcript variant B (numb), mRNA 
0   NM_142060.3  CG9286-RA (CG9286), mRNA 
0   33  NM_132522.2  CG32662-RA (CG32662), mRNA 
0   NM_164564.1  CG31957-RA (CG31957), mRNA 
0   NM_141965.1  CG14395-RA (CG14395), mRNA 
0   NM_140645.1  CG13033-RA (CG13033), mRNA 
0   NM_057737.2  CG15804-RA, transcript variant A (Dhc62B), mRNA 
0   NM_206236.1  CG15804-RB, transcript variant B (Dhc62B), mRNA 
0   NM_176293.1  CG33171-RC, transcript variant C (CG33171), mRNA 
0   NM_176294.2  CG33171-RE, transcript variant E (CG33171), mRNA 
0   NM_137427.2  CG5036-RA (CG5036), mRNA 
0   NM_167128.1  CG32719-RA (CG32719), mRNA 
0   NM_139478.1  CG1143-RA (CG1143), mRNA 
0   NM_170502.1  CG2239-RC, transcript variant C (jdp), mRNA 
0   NM_170501.1  CG2239-RB, transcript variant B (jdp), mRNA 
0   NM_143550.2  CG2239-RA, transcript variant A (jdp), mRNA 
0   NM_141852.1  CG12594-RA (CG12594), mRNA 
0   11  NM_140759.2  CG5546-RA (MED19), mRNA 
0   NM_135935.2  CG12455-RA, transcript variant A (CG12455), mRNA 
0   NM_165149.1  CG12455-RB, transcript variant B (CG12455), mRNA 
0   NM_134668.1  CG17078-RA (CG17078), mRNA 
0   NM_141774.2  CG4596-RA (CG4596), mRNA 
0   NM_141324.1  CG1098-RA (Madm), mRNA 
0   NM_080376.1  CG8118-RA, transcript variant A (mam), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.