National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31617R-3 
 Symbol His1:CG31617  Full Name His1:CG31617 
 CG No CG31617  Old CG No CG31617 
 Synonyms CG31617, His1:CG31617 
 Accession No (Link to NCBI) NM_165380.3 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Bayona-Feliu A, Casas-Lamesa A, Reina O, Bernués J, Azorín F.
Linker histone H1 prevents R-loop accumulation and genome instability in heterochromatin.
Nat Commun (2017) 8(1) 283 [ PubMed ID = 28819201 ] [ RRC reference ]

Vujatovic O, Zaragoza K, Vaquero A, Reina O, Bernués J, Azorín F.
Drosophila melanogaster linker histone dH1 is required for transposon silencing and to preserve genome integrity.
Nucleic Acids Res. (2012) 40(12) 5402-14 [ PubMed ID = 22406835 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGCAAAGAAAGCCTCTGCGAC 
 Primer Seq. 3'
aatctagaggtaccCGGCGGGCTTCGACTTTATGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGNAAAGAAA GCCTCTGCGA CGcCGTCACA TCCGCCAACT CAGCAAATGG TGGACGCTTC 
0061 CATTAAAAAT TTAAAGGAAC GTGGCGGTTC ATCACTTCTG GCAATCAAAA AATATATCAC 
0121 TGCCACTTAT AAATGCGACG CCCAAAAGTT AGCGCCATTC ATCAAGAAGT ACTTAAAATC 
0181 GGCCGTGATC AATGGAAAGC TTATCCAAAC TAAGGGAAAG GGTGCATCTG GATCTTTCAA 
0241 ACTGTCGGCC TCTGCCAAGA AGGAAAAGGA TCCGAAGGCA AAGTCGAAGG TTTTGTCTGC 
0301 TGAGAAAAAA GTTCAAAGCA AGAAGGTAGC CTCTAAGAAG ATTGGTGTCT CCTCTAAAAA 
0361 AACTGCCGTT GGGGCTGCTG ACAAAAAGCC CAAAGCTAAG AAGGCTGTGG CTACCAAAAA 
0421 GACTGCCGAA AATAAGAAAA CTGAGAAGGC AAAAGCCAAG GATGCCAAGA AAACTGGAAT 
0481 CATAAAGTCG AAGCCCGCCG  
 in silico PCR Fragment
0001 GGCAAAGAAA GCCTCTGCGA CGCCGTCACA TCCGCCAACT CAGCAAATGG TGGACGCTTC 
0061 CATTAAAAAT TTAAAGGAAC GTGGCGGTTC ATCACTTCTG GCAATCAAAA AATATATCAC 
0121 TGCCACTTAT AAATGCGACG CCCAAAAGTT AGCGCCATTC ATCAAGAAGT ACTTAAAATC 
0181 GGCCGTGGTC AATGGAAAGC TTATCCAAAC TAAGGGAAAG GGTGCATCTG GATCTTTCAA 
0241 ACTGTCGGCC TCTGCCAAGA AGGAAAAGGA TCCGAAGGCA AAGTCGAAGG TTTTGTCTGC 
0301 TGAGAAAAAA GTTCAAAGCA AGAAGGTAGC CTCTAAGAAG ATTGGTGTCT CCTCTAAAAA 
0361 AACTGCCGTT GGGGCTGCTG ACAAAAAGCC CAAAGCTAAG AAGGCTGTGG CTACCAAAAA 
0421 GACTGCCGAA AATAAGAAAA CTGAGAAGGC AAAAGCCAAG GATGCCAAGA AAACTGGAAT 
0481 CATAAAGTCG AAGCCCGCCG  
 Assemble Data

31617R-3.IR_full       1   GGNAAAGAAAGCCTCTGCGACGCCGTCACATCCGCCAACTCAGCAAATGGTGGACGCTTC 60
                           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31617R-3.in silico     1   GGCAAAGAAAGCCTCTGCGACGCCGTCACATCCGCCAACTCAGCAAATGGTGGACGCTTC 60


31617R-3.IR_full       61  CATTAAAAATTTAAAGGAACGTGGCGGTTCATCACTTCTGGCAATCAAAAAATATATCAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31617R-3.in silico     61  CATTAAAAATTTAAAGGAACGTGGCGGTTCATCACTTCTGGCAATCAAAAAATATATCAC 120


31617R-3.IR_full       121 TGCCACTTATAAATGCGACGCCCAAAAGTTAGCGCCATTCATCAAGAAGTACTTAAAATC 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31617R-3.in silico     121 TGCCACTTATAAATGCGACGCCCAAAAGTTAGCGCCATTCATCAAGAAGTACTTAAAATC 180


31617R-3.IR_full       181 GGCCGTGATCAATGGAAAGCTTATCCAAACTAAGGGAAAGGGTGCATCTGGATCTTTCAA 240
                           ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||
31617R-3.in silico     181 GGCCGTGGTCAATGGAAAGCTTATCCAAACTAAGGGAAAGGGTGCATCTGGATCTTTCAA 240


31617R-3.IR_full       241 ACTGTCGGCCTCTGCCAAGAAGGAAAAGGATCCGAAGGCAAAGTCGAAGGTTTTGTCTGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31617R-3.in silico     241 ACTGTCGGCCTCTGCCAAGAAGGAAAAGGATCCGAAGGCAAAGTCGAAGGTTTTGTCTGC 300


31617R-3.IR_full       301 TGAGAAAAAAGTTCAAAGCAAGAAGGTAGCCTCTAAGAAGATTGGTGTCTCCTCTAAAAA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31617R-3.in silico     301 TGAGAAAAAAGTTCAAAGCAAGAAGGTAGCCTCTAAGAAGATTGGTGTCTCCTCTAAAAA 360


31617R-3.IR_full       361 AACTGCCGTTGGGGCTGCTGACAAAAAGCCCAAAGCTAAGAAGGCTGTGGCTACCAAAAA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31617R-3.in silico     361 AACTGCCGTTGGGGCTGCTGACAAAAAGCCCAAAGCTAAGAAGGCTGTGGCTACCAAAAA 420


31617R-3.IR_full       421 GACTGCCGAAAATAAGAAAACTGAGAAGGCAAAAGCCAAGGATGCCAAGAAAACTGGAAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31617R-3.in silico     421 GACTGCCGAAAATAAGAAAACTGAGAAGGCAAAAGCCAAGGATGCCAAGAAAACTGGAAT 480


31617R-3.IR_full       481 CATAAAGTCGAAGCCCGCCG 500
                           ||||||||||||||||||||
31617R-3.in silico     481 CATAAAGTCGAAGCCCGCCG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.