National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31617R-2 
 Symbol His1:CG31617  Full Name His1:CG31617 
 CG No CG31617  Old CG No CG31617 
 Synonyms CG31617, His1:CG31617 
 Accession No (Link to NCBI) NM_165380.3 
 Inserted Chr. ll 
 Insertional Mutation  3 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Vujatovic O, Zaragoza K, Vaquero A, Reina O, Bernués J, Azorín F.
Drosophila melanogaster linker histone dH1 is required for transposon silencing and to preserve genome integrity.
Nucleic Acids Res. (2012) 40(12) 5402-14 [ PubMed ID = 22406835 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGCAAAGAAAGCCTCTGCGACGCCGTCACATCCGCCAACTCAGCAAATGGTGGACGCTTC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CATTAAAAATTTAAAGGAACGTGGCGGTTCATCACTTCTGGCAATCAAAAAATATATCAC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 TGCCACTTATAAATGCGACGCCCAAAAGTTAGCGCCATTCATCAAGAAGTACTTAAAATC 180

                           ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GGCCGTGGTCAATGGAAAGCTTATCCAAACTAAGGGAAAGGGTGCATCTGGATCTTTCAA 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 ACTGTCGGCCTCTGCCAAGAAGGAAAAGGATCCGAAGGCAAAGTCGAAGGTTTTGTCTGC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGAGAAAAAAGTTCAAAGCAAGAAGGTAGCCTCTAAGAAGATTGGTGTCTCCTCTAAAAA 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 AACTGCCGTTGGGGCTGCTGACAAAAAGCCCAAAGCTAAGAAGGCTGTGGCTACCAAAAA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 GACTGCCGAAAATAAGAAAACTGAGAAGGCAAAAGCCAAGGATGCCAAGAAAACTGGAAT 480

31617R-2.IR_full       481 CATAAAGTCGAAGCCCGCCG 500
                           |||||||||||||||||||| silico     481 CATAAAGTCGAAGCCCGCCG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.