National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3153R-3 
 Symbol CG3153  Full Name CG3153 
 CG No CG3153  Old CG No CG3153 
 Synonyms CT10556, DmML2, CG3153 
 Accession No (Link to NCBI) NM_169568.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ito S, Ueda T, Ueno A, Nakagawa H, Taniguchi H, Kayukawa N, Miki T.
A genetic screen in Drosophila for regulators of human prostate cancer progression.
Biochem. Biophys. Res. Commun. (2014) 451(4) 548-55 [ PubMed ID = 25117438 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTTTGTGATCTTCGCCGCTTTG 
 Primer Seq. 3'
aatctagaggtaccAGCCTTGATTTTGGCGGGTAT 
 Predicted Fragment Size
456 
 IR fragment full Seq
0001 TTTGTGATCT TCGCCGCTTT GATCgGCTTC ACGTCGTCCA CGNATGTGAG TCAGTGCCCG 
0061 AAATCCAAAT CGAAGGCCCT AGCTGCCGGT GACGTCTCCA TTTCCAATTG CCCCAAGAGC 
0121 AAGTGCATCC TGAAGCGCAA CACGGAGGCC AGCATTCAGA TGAAGATCCG GCCGGAGCGC 
0181 GACTTCCAGG AGCTGACCTC CGACATCCAG GGCATTATCC TGGACGTGCC GCTGCCGTTC 
0241 CCAGGATATT NACGGCACCA GCGCCTGTCC GCACATCTAC GACGAGGCTG GCGAGAAGAA 
0301 GGTGGGCTGC CCACTGAAGG CCGGCCAGGT GTACACCTAC AAGAACAGCT TCAAGATCCT 
0361 GCCCGTCTAC CCGACCGTCA GTTTGGAGAT CCACTGGGGA TTGGGCGATA AGCATGGGGA 
0421 TGCGGCCTGC TTCCAGATAC CCGCCAAAAT CAAGGCT 
 in silico PCR Fragment
0001 TTTGTGATCT TCGCCGCTTT GATCGGCTTC ACGTCGTCCA CGGATGTGAG TCAGTGCCCG 
0061 AAATCCAAAT CGAAGGCCCT AGCTGCCGGT GACGTCTCCA TTTCCAATTG CCCCAAGAGC 
0121 AAGTGCATCC TGAAGCGCAA CACGGAGGCC AGCATTCAGA TGAAGATCCG GCCGGAGCGC 
0181 GACTTCCAGG AGCTGACCTC CGACATCCAG GGCATTATCC TGGACGTGCC GCTGCCGTTC 
0241 CCAGGATATT -ACGGCACCA GCGCCTGTCC GCACATCTAC GACGAGGCTG GCGAGAAGAA 
0301 GGTGGGCTGC CCACTGAAGG CCGGCCAGGT GTACACCTAC AAGAACAGCT TCAAGATCCT 
0361 GCCCGTCTAC CCGACCGTCA GTTTGGAGAT CCACTGGGGA TTGGGCGATA AGCATGGGGA 
0421 TGCGGCCTGC TTCCAGATAC CCGCCAAAAT CAAGGCT 
 Assemble Data

3153R-3.IR_full       1   TTTGTGATCTTCGCCGCTTTGATCGGCTTCACGTCGTCCACGNATGTGAGTCAGTGCCCG 60
                          |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||
3153R-3.in silico     1   TTTGTGATCTTCGCCGCTTTGATCGGCTTCACGTCGTCCACGGATGTGAGTCAGTGCCCG 60


3153R-3.IR_full       61  AAATCCAAATCGAAGGCCCTAGCTGCCGGTGACGTCTCCATTTCCAATTGCCCCAAGAGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3153R-3.in silico     61  AAATCCAAATCGAAGGCCCTAGCTGCCGGTGACGTCTCCATTTCCAATTGCCCCAAGAGC 120


3153R-3.IR_full       121 AAGTGCATCCTGAAGCGCAACACGGAGGCCAGCATTCAGATGAAGATCCGGCCGGAGCGC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3153R-3.in silico     121 AAGTGCATCCTGAAGCGCAACACGGAGGCCAGCATTCAGATGAAGATCCGGCCGGAGCGC 180


3153R-3.IR_full       181 GACTTCCAGGAGCTGACCTCCGACATCCAGGGCATTATCCTGGACGTGCCGCTGCCGTTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3153R-3.in silico     181 GACTTCCAGGAGCTGACCTCCGACATCCAGGGCATTATCCTGGACGTGCCGCTGCCGTTC 240


3153R-3.IR_full       241 CCAGGATATTNACGGCACCAGCGCCTGTCCGCACATCTACGACGAGGCTGGCGAGAAGAA 300
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
3153R-3.in silico     241 CCAGGATATT-ACGGCACCAGCGCCTGTCCGCACATCTACGACGAGGCTGGCGAGAAGAA 300


3153R-3.IR_full       301 GGTGGGCTGCCCACTGAAGGCCGGCCAGGTGTACACCTACAAGAACAGCTTCAAGATCCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3153R-3.in silico     301 GGTGGGCTGCCCACTGAAGGCCGGCCAGGTGTACACCTACAAGAACAGCTTCAAGATCCT 360


3153R-3.IR_full       361 GCCCGTCTACCCGACCGTCAGTTTGGAGATCCACTGGGGATTGGGCGATAAGCATGGGGA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3153R-3.in silico     361 GCCCGTCTACCCGACCGTCAGTTTGGAGATCCACTGGGGATTGGGCGATAAGCATGGGGA 420


3153R-3.IR_full       421 TGCGGCCTGCTTCCAGATACCCGCCAAAATCAAGGCT 457
                          |||||||||||||||||||||||||||||||||||||
3153R-3.in silico     421 TGCGGCCTGCTTCCAGATACCCGCCAAAATCAAGGCT 457

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   438  NM_142074.2  CG3153-RB, transcript variant B (CG3153), mRNA 
100   438  NM_169568.1  CG3153-RA, transcript variant A (CG3153), mRNA 
0   NM_137010.1  CG4679-RA (CG4679), mRNA 
0   NM_166835.1  CG2945-RB, transcript variant B (cin), mRNA 
0   NM_057682.2  CG2945-RA, transcript variant A (cin), mRNA 
0   NM_167843.1  CG13887-RC, transcript variant C (CG13887), mRNA 
0   NM_138218.2  CG13887-RB, transcript variant B (CG13887), mRNA 
0   NM_137193.1  CG12959-RA (CG12959), mRNA 
0   NM_169548.1  CG9351-RB, transcript variant B (flfl), mRNA 
0   NM_169549.1  CG9351-RC, transcript variant C (flfl), mRNA 
0   NM_142047.1  CG9351-RA, transcript variant A (flfl), mRNA 
0   NM_134544.1  CG11734-RB (HERC2), mRNA 
0   NM_142787.1  CG12499-RA (CG12499), mRNA 
0   NM_132457.1  CG11122-RA (CG11122), mRNA 
0   NM_138130.2  CG30420-RB, transcript variant B (Atf-2), mRNA 
0   NM_166690.1  CG30420-RA, transcript variant A (Atf-2), mRNA 
0   NM_176374.1  CG4761-RA (knrl), mRNA 
0   NM_206286.1  CG10107-RC, transcript variant C (CG10107), mRNA 
0   NM_139799.3  CG10107-RA, transcript variant A (CG10107), mRNA 
0   NM_132103.2  CG3973-RA (CG3973), mRNA 
0   NM_137816.1  CG5819-RA, transcript variant A (CG5819), mRNA 
0   NM_166523.1  CG5819-RB, transcript variant B (CG5819), mRNA 
0   NM_079643.1  CG5178-RA (Act88F), mRNA 
0   NM_166258.1  CG5784-RA, transcript variant A (Mapmodulin), mRNA 
0   NM_079056.2  CG5784-RB, transcript variant B (Mapmodulin), mRNA 
0   NM_001042869.1  CG34125-RA (CG34125), mRNA 
0   NM_206294.1  CG33275-RA, transcript variant A (CG33275), mRNA 
0   NM_206295.1  CG33275-RB, transcript variant B (CG33275), mRNA 
0   NM_206293.1  CG33275-RC, transcript variant C (CG33275), mRNA 
0   NM_143320.2  CG18437-RA (CG18437), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
+- 
DM
 
VM
 
VB
 
Caspase-3 signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.