National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock temporarily unavailable request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31348R-1 
 Symbol Octbeta3R  Full Name Octbeta3R 
 CG No CG33959  Old CG No CG31348 
 Synonyms CG7078, DmOctbeta3R, CG33959, DmCG7078, CG31350, CG31351, CG31348, anon-WO0170980.188, anon-WO0170980.187, Octbeta3R, OctBeta3 
 Accession No (Link to NCBI) NM_001038958.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval/pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ohhara Y, Shimada-Niwa Y, Niwa R, Kayashima Y, Hayashi Y, Akagi K, Ueda H, Yamakawa-Kobayashi K, Kobayashi S.
Autocrine regulation of ecdysone synthesis by β3-octopamine receptor in the prothoracic gland is essential for Drosophila metamorphosis.
Proc. Natl. Acad. Sci. U.S.A. (2015) 112(5) 1452-7 [ PubMed ID = 25605909 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGGTTAACGTGGCTGACCTTC 
 Primer Seq. 3'
aatctagaggtaccCTTTCGATTGCGCTGCACTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGGTTAACGT GGCTGACCTT CTGGCCACGA CAATGACATT ACCCATAACA GCCGCAGCAG 
0061 GAGCAGCAAC ATCACAAGCA GCAGCAACAT CAGCCACCAA CGCCAGCCAC CTGCAACCTG 
0121 CAACATTAAC AGGCCACATT TCCACGACAG CAGCAGCCAA AACTACGACG ACGCCGACGA 
0181 GCAGTTTGCC TATAACATCG CAATTTGTGG ATGCCTCGTT GACTTCGCTA TCATTAACAG 
0241 CCACATCGTC AGATGCCTCC TACTCCTCGC CCTTTTCATC CTACTTGTCG TCGGATTCCA 
0301 CGTTTGAGCT CCTCTCGACA GTCGGCCCAA ATATAACGGC CAATGGCAGT GACATTACGG 
0361 TGGATAACCA GGCGGAGCTG GNAGGAGAGC TGGCTAGATC TANTCGCTGC TGCTGCTCAA 
0421 AGGATTCATC TTCTCGTCAA TTATCCTGGC CGCTGTCCTC GGCAATGCAT TGGTCATCAT 
0481 TTCAGTGCAG CGCAATCGAA AG 
 in silico PCR Fragment
0001 GGGTTAACGT GGCTGACCTT CTGGCCACGA CAATGACATT ACCCATAACA GCCGCAGCAG 
0061 GAGCAGCAAC ATCACAAGCA GCAGCAACAT CAGCCACCAA CGCCAGCCAC CTGCAACCTG 
0121 CAACATTAAC AGGCCACATT TCCACGACAG CAGCAGCCAA AACTACGACG ACGCCGACGA 
0181 GCAGTTTGCC TATAACATCG CAATTTGTGG ATGCCTCGTT GACTTCGCTA TCATTAACAG 
0241 CCACATCGTC AGATGCCTCC TACTCCTCGC CCTTTTCATC CTACTTGTCG TCGGATTCCA 
0301 CGTTTGAGCT CCTCTCGACA GTCGGCCCAA ATATAACGGC CAATGGCAGT GACATTGCGG 
0361 TGGATAACCA GGCGGAGCTG G-AGGAGAGC TGGCTGGATC TA-TCGCTGC TGCTGCTCAA 
0421 AGGATTCATC TTCTCGTCAA TTATCCTGGC CGCTGTCCTC GGCAATGCAT TGGTCATCAT 
0481 TTCAGTGCAG CGCAATCGAA AG 
 Assemble Data

31348R-1.IR_full       1   GGGTTAACGTGGCTGACCTTCTGGCCACGACAATGACATTACCCATAACAGCCGCAGCAG 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31348R-1.in silico     1   GGGTTAACGTGGCTGACCTTCTGGCCACGACAATGACATTACCCATAACAGCCGCAGCAG 60


31348R-1.IR_full       61  GAGCAGCAACATCACAAGCAGCAGCAACATCAGCCACCAACGCCAGCCACCTGCAACCTG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31348R-1.in silico     61  GAGCAGCAACATCACAAGCAGCAGCAACATCAGCCACCAACGCCAGCCACCTGCAACCTG 120


31348R-1.IR_full       121 CAACATTAACAGGCCACATTTCCACGACAGCAGCAGCCAAAACTACGACGACGCCGACGA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31348R-1.in silico     121 CAACATTAACAGGCCACATTTCCACGACAGCAGCAGCCAAAACTACGACGACGCCGACGA 180


31348R-1.IR_full       181 GCAGTTTGCCTATAACATCGCAATTTGTGGATGCCTCGTTGACTTCGCTATCATTAACAG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31348R-1.in silico     181 GCAGTTTGCCTATAACATCGCAATTTGTGGATGCCTCGTTGACTTCGCTATCATTAACAG 240


31348R-1.IR_full       241 CCACATCGTCAGATGCCTCCTACTCCTCGCCCTTTTCATCCTACTTGTCGTCGGATTCCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31348R-1.in silico     241 CCACATCGTCAGATGCCTCCTACTCCTCGCCCTTTTCATCCTACTTGTCGTCGGATTCCA 300


31348R-1.IR_full       301 CGTTTGAGCTCCTCTCGACAGTCGGCCCAAATATAACGGCCAATGGCAGTGACATTACGG 360
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
31348R-1.in silico     301 CGTTTGAGCTCCTCTCGACAGTCGGCCCAAATATAACGGCCAATGGCAGTGACATTGCGG 360


31348R-1.IR_full       361 TGGATAACCAGGCGGAGCTGGNAGGAGAGCTGGCTAGATCTANTCGCTGCTGCTGCTCAA 420
                           ||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||
31348R-1.in silico     361 TGGATAACCAGGCGGAGCTGG-AGGAGAGCTGGCTGGATCTA-TCGCTGCTGCTGCTCAA 420


31348R-1.IR_full       421 AGGATTCATCTTCTCGTCAATTATCCTGGCCGCTGTCCTCGGCAATGCATTGGTCATCAT 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31348R-1.in silico     421 AGGATTCATCTTCTCGTCAATTATCCTGGCCGCTGTCCTCGGCAATGCATTGGTCATCAT 480


31348R-1.IR_full       481 TTCAGTGCAGCGCAATCGAAAG 502
                           ||||||||||||||||||||||
31348R-1.in silico     481 TTCAGTGCAGCGCAATCGAAAG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001038955.1  CG33959-RC, transcript variant C (Octbeta3R), mRNA 
100   482  NM_001038956.1  CG33959-RE, transcript variant E (Octbeta3R), mRNA 
100   482  NM_001038957.1  CG33959-RB, transcript variant B (Octbeta3R), mRNA 
100   482  NM_001038954.1  CG33959-RD, transcript variant D (Octbeta3R), mRNA 
100   482  NM_001038958.1  CG33959-RA, transcript variant A (Octbeta3R), mRNA 
0.62   28  110  NM_144133.1  CG13235-RA (CG13235), mRNA 
0.62   11  35  NM_206413.1  CG18023-RC, transcript variant C (Eip78C), mRNA 
0.62   16  120  NM_079471.2  CG18023-RA, transcript variant A (Eip78C), mRNA 
0.62   16  120  NM_168892.1  CG18023-RB, transcript variant B (Eip78C), mRNA 
0.41   10  25  NM_140588.1  CG13073-RB, transcript variant B (CG13073), mRNA 
0.41   10  25  NM_168654.1  CG13073-RA, transcript variant A (CG13073), mRNA 
0.2   NM_057624.2  CG4698-RA (Wnt4), mRNA 
0.2   32  206  NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
0.2   32  206  NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
0.2   21  138  NM_170478.1  CG15532-RB, transcript variant B (hdc), mRNA 
0.2   11  32  NM_144190.1  CG13673-RA (CG13673), mRNA 
0.2   13  87  NM_142521.1  CG6026-RA (CG6026), mRNA 
0.2   10  29  NM_142396.1  CG7397-RA (CG7397), mRNA 
0.2   32  NM_168681.2  CG3849-RB, transcript variant B (Lasp), mRNA 
0.2   12  NM_140655.1  CG3849-RA, transcript variant A (Lasp), mRNA 
0.2   19  48  NM_139748.1  CG13291-RA (CG13291), mRNA 
0.2   67  NM_057326.4  CG12212-RA, transcript variant A (peb), mRNA 
0.2   67  NM_001014722.1  CG12212-RB, transcript variant B (peb), mRNA 
0.2   18  NM_139786.1  CG13300-RA (CG13300), mRNA 
0   12  19  61  NM_080079.2  CG32120-RA (sens), mRNA 
0   245  1170  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   245  1170  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   245  1170  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   49  172  NM_132351.1  CG1343-RA, transcript variant A (Sp1), mRNA 
0   49  172  NM_167200.1  CG1343-RB, transcript variant B (Sp1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.