National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31348R-1 
 Symbol Octbeta3R  Full Name Octbeta3R 
 CG No CG33959  Old CG No CG31348 
 Synonyms CG7078, DmOctbeta3R, CG33959, DmCG7078, CG31350, CG31351, CG31348, anon-WO0170980.188, anon-WO0170980.187, Octbeta3R, OctBeta3 
 Accession No (Link to NCBI) NM_001038958.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval/pupal lethal 
 Map Viewer
[Please submit your publication]
Ohhara Y, Shimada-Niwa Y, Niwa R, Kayashima Y, Hayashi Y, Akagi K, Ueda H, Yamakawa-Kobayashi K, Kobayashi S.
Autocrine regulation of ecdysone synthesis by β3-octopamine receptor in the prothoracic gland is essential for Drosophila metamorphosis.
Proc. Natl. Acad. Sci. U.S.A. (2015) 112(5) 1452-7 [ PubMed ID = 25605909 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGGTTAACGTGGCTGACCTTCTGGCCACGACAATGACATTACCCATAACAGCCGCAGCAG 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GAGCAGCAACATCACAAGCAGCAGCAACATCAGCCACCAACGCCAGCCACCTGCAACCTG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CAACATTAACAGGCCACATTTCCACGACAGCAGCAGCCAAAACTACGACGACGCCGACGA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GCAGTTTGCCTATAACATCGCAATTTGTGGATGCCTCGTTGACTTCGCTATCATTAACAG 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCACATCGTCAGATGCCTCCTACTCCTCGCCCTTTTCATCCTACTTGTCGTCGGATTCCA 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| silico     301 CGTTTGAGCTCCTCTCGACAGTCGGCCCAAATATAACGGCCAATGGCAGTGACATTGCGG 360

                           ||||||||||||||||||||| ||||||||||||| |||||| ||||||||||||||||| silico     361 TGGATAACCAGGCGGAGCTGG-AGGAGAGCTGGCTGGATCTA-TCGCTGCTGCTGCTCAA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AGGATTCATCTTCTCGTCAATTATCCTGGCCGCTGTCCTCGGCAATGCATTGGTCATCAT 480

31348R-1.IR_full       481 TTCAGTGCAGCGCAATCGAAAG 502
                           |||||||||||||||||||||| silico     481 TTCAGTGCAGCGCAATCGAAAG 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_001038955.1  CG33959-RC, transcript variant C (Octbeta3R), mRNA 
100   482  NM_001038956.1  CG33959-RE, transcript variant E (Octbeta3R), mRNA 
100   482  NM_001038957.1  CG33959-RB, transcript variant B (Octbeta3R), mRNA 
100   482  NM_001038954.1  CG33959-RD, transcript variant D (Octbeta3R), mRNA 
100   482  NM_001038958.1  CG33959-RA, transcript variant A (Octbeta3R), mRNA 
0.62   28  110  NM_144133.1  CG13235-RA (CG13235), mRNA 
0.62   11  35  NM_206413.1  CG18023-RC, transcript variant C (Eip78C), mRNA 
0.62   16  120  NM_079471.2  CG18023-RA, transcript variant A (Eip78C), mRNA 
0.62   16  120  NM_168892.1  CG18023-RB, transcript variant B (Eip78C), mRNA 
0.41   10  25  NM_140588.1  CG13073-RB, transcript variant B (CG13073), mRNA 
0.41   10  25  NM_168654.1  CG13073-RA, transcript variant A (CG13073), mRNA 
0.2   NM_057624.2  CG4698-RA (Wnt4), mRNA 
0.2   32  206  NM_176591.1  CG15532-RC, transcript variant C (hdc), mRNA 
0.2   32  206  NM_079853.2  CG15532-RA, transcript variant A (hdc), mRNA 
0.2   21  138  NM_170478.1  CG15532-RB, transcript variant B (hdc), mRNA 
0.2   11  32  NM_144190.1  CG13673-RA (CG13673), mRNA 
0.2   13  87  NM_142521.1  CG6026-RA (CG6026), mRNA 
0.2   10  29  NM_142396.1  CG7397-RA (CG7397), mRNA 
0.2   32  NM_168681.2  CG3849-RB, transcript variant B (Lasp), mRNA 
0.2   12  NM_140655.1  CG3849-RA, transcript variant A (Lasp), mRNA 
0.2   19  48  NM_139748.1  CG13291-RA (CG13291), mRNA 
0.2   67  NM_057326.4  CG12212-RA, transcript variant A (peb), mRNA 
0.2   67  NM_001014722.1  CG12212-RB, transcript variant B (peb), mRNA 
0.2   18  NM_139786.1  CG13300-RA (CG13300), mRNA 
0   12  19  61  NM_080079.2  CG32120-RA (sens), mRNA 
0   245  1170  NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   245  1170  NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   245  1170  NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   49  172  NM_132351.1  CG1343-RA, transcript variant A (Sp1), mRNA 
0   49  172  NM_167200.1  CG1343-RB, transcript variant B (Sp1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.