National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notice:

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31326R-1 
 Symbol CG31326  Full Name CG31326 
 CG No CG31326  Old CG No CG31326 
 Synonyms CG9645, SPH144, CG31326, cg9645 
 Accession No (Link to NCBI) NM_142087.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Droujinine IA, Meyer AS, Wang D, Udeshi ND, Hu Y, Rocco D, McMahon JA, Yang R, Guo J, Mu L, Carey DK, Svinkina T, Zeng R, Branon T, Tabatabai A, Bosch JA, Asara JM, Ting AY, Carr SA, McMahon AP, Perrimon N.
Proteomics of protein trafficking by in vivo tissue-specific labeling.
Nat Commun (2021) 12(1) 2382 [ PubMed ID = 33888706 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTTCTCCTTCTGGCTTCTCTG 
 Primer Seq. 3'
aatctagaggtaccCTGGTTTCCCTGTAGTCTATC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTTCTCCTTC TGGCTTCTCT GATTAACTTG GTTCTTGGCC AGTTGCCCCG GAATGGCTGC 
0061 TCTGGGCGAT TTCAATACCA GGGCTACCAG GGGCAGTACA TCGGTTTGGT GGAAGTTCGT 
0121 CATCCGGAGG CCAATAACCA GACACTCATC CTTCAATTCT CCCAGCAGGG ATATCACGAT 
0181 TTCGAAGACT ATGTGGGCAG TATCTCTCTG GTGGATGATG ATGAAGTGAC CCAGGAAAAT 
0241 CTGCGTCAGG GCTTGCCGAT TAGATACCGT GTGGATTTTC CTATTCCAAC AATACCGCCC 
0301 AAGATCACTA GCATGCAATT GAATGGCGTA CAACTTTGTA GTGGCGGTGT ATATCCTAAG 
0361 CCAAGAACCG GCATTACGCT GCGAATCACT TGGACGCCCT CCTACATATC GGGTTTTCGG 
0421 GCGTTAATCC CCCAACCTGT GCCAACCAGA CCTCGACCCC GCTTGGCAAA GATGAAAAGT 
0481 CCACAGATAG ACTACAGGGA AACCAG 
 in silico PCR Fragment
0001 GTTCTCCTTC TGGCTTCTCT GATTAACTTG GTTCTTGGCC AGTTGCCCCG GAATGGCTGC 
0061 TCTGGGCGAT TTCAATACCA GGGCTACCAG GGGCAGTACA TCGGTTTGGT GGAAGTTCGT 
0121 CATCCGGAGG CCAATAACCA GACACTCATC CTTCAATTCT CCCAGCAGGG ATATCACGAT 
0181 TTCGAAGACT ATGTGGGCAG TATCTCTCTG GTGGATGATG ATGAAGTGAC CCAGGAAAAT 
0241 CTGCGTCAGG GCTTGCCGAT TAGATACCGT GTGGATTTTC CTATTCCAAC AATACCGCCC 
0301 AAGATCACTA GCATGCAATT GAATGGCGTA CAACTTTGTA GTGGCGGTGT ATATCCTAAG 
0361 CCAAGAACCG GCATTACGCT GCGAATCACT TGGACGCCCT CCTACATATC -GGTTTTC-G 
0421 GCGTTAAT-C CCCAACCTGT GCCAACCAGA CCTCGA-CCC GCTTGGC-AA GATG-AAAGT 
0481 CCACAGATAG ACTACAGGGA AACCAG 
 Assemble Data

31326R-1.IR_full       1   GTTCTCCTTCTGGCTTCTCTGATTAACTTGGTTCTTGGCCAGTTGCCCCGGAATGGCTGC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31326R-1.in silico     1   GTTCTCCTTCTGGCTTCTCTGATTAACTTGGTTCTTGGCCAGTTGCCCCGGAATGGCTGC 60


31326R-1.IR_full       61  TCTGGGCGATTTCAATACCAGGGCTACCAGGGGCAGTACATCGGTTTGGTGGAAGTTCGT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31326R-1.in silico     61  TCTGGGCGATTTCAATACCAGGGCTACCAGGGGCAGTACATCGGTTTGGTGGAAGTTCGT 120


31326R-1.IR_full       121 CATCCGGAGGCCAATAACCAGACACTCATCCTTCAATTCTCCCAGCAGGGATATCACGAT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31326R-1.in silico     121 CATCCGGAGGCCAATAACCAGACACTCATCCTTCAATTCTCCCAGCAGGGATATCACGAT 180


31326R-1.IR_full       181 TTCGAAGACTATGTGGGCAGTATCTCTCTGGTGGATGATGATGAAGTGACCCAGGAAAAT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31326R-1.in silico     181 TTCGAAGACTATGTGGGCAGTATCTCTCTGGTGGATGATGATGAAGTGACCCAGGAAAAT 240


31326R-1.IR_full       241 CTGCGTCAGGGCTTGCCGATTAGATACCGTGTGGATTTTCCTATTCCAACAATACCGCCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31326R-1.in silico     241 CTGCGTCAGGGCTTGCCGATTAGATACCGTGTGGATTTTCCTATTCCAACAATACCGCCC 300


31326R-1.IR_full       301 AAGATCACTAGCATGCAATTGAATGGCGTACAACTTTGTAGTGGCGGTGTATATCCTAAG 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31326R-1.in silico     301 AAGATCACTAGCATGCAATTGAATGGCGTACAACTTTGTAGTGGCGGTGTATATCCTAAG 360


31326R-1.IR_full       361 CCAAGAACCGGCATTACGCTGCGAATCACTTGGACGCCCTCCTACATATCGGGTTTTCGG 420
                           |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
31326R-1.in silico     361 CCAAGAACCGGCATTACGCTGCGAATCACTTGGACGCCCTCCTACATATC-GGTTTTC-G 420


31326R-1.IR_full       421 GCGTTAATCCCCCAACCTGTGCCAACCAGACCTCGACCCCGCTTGGCAAAGATGAAAAGT 480
                           |||||||| ||||||||||||||||||||||||||| |||||||||| |||||| |||||
31326R-1.in silico     421 GCGTTAAT-CCCCAACCTGTGCCAACCAGACCTCGA-CCCGCTTGGC-AAGATG-AAAGT 480


31326R-1.IR_full       481 CCACAGATAGACTACAGGGAAACCAG 506
                           ||||||||||||||||||||||||||
31326R-1.in silico     481 CCACAGATAGACTACAGGGAAACCAG 506

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_142087.2  CG31326-RA (CG31326), mRNA 
0   NM_057540.3  CG5193-RA (TfIIB), mRNA 
0   NM_136262.2  CG2042-RA (CG2042), mRNA 
0   NM_169826.1  CG31224-RA (CG31224), mRNA 
0   NM_170158.1  CG5794-RB, transcript variant B (CG5794), mRNA 
0   NM_143018.2  CG5794-RD, transcript variant D (CG5794), mRNA 
0   NM_001043253.1  CG14885-RC, transcript variant C (Gyc-89Da), mRNA 
0   NM_001043254.1  CG14885-RB, transcript variant B (Gyc-89Da), mRNA 
0   NM_130662.2  CG2662-RA (CG2662), mRNA 
0   NM_143114.1  CG10514-RA (CG10514), mRNA 
0   NM_167144.2  CG2252-RA, transcript variant A (fs(1)h), mRNA 
0   NM_206647.1  CG2252-RC, transcript variant C (fs(1)h), mRNA 
0   NM_206646.1  CG2252-RD, transcript variant D (fs(1)h), mRNA 
0   NM_206645.1  CG2252-RE, transcript variant E (fs(1)h), mRNA 
0   NM_134871.1  CG3131-RA (Duox), mRNA 
0   NM_164316.2  CG31516-RA (CG31516), mRNA 
0   NM_058041.2  CG12467-RA (CG12467), mRNA 
0   NM_130492.2  CG13366-RA, transcript variant A (CG13366), mRNA 
0   NM_001042789.1  CG13366-RB, transcript variant B (CG13366), mRNA 
0   NM_137058.2  CG12295-RB (stj), mRNA 
0   14  NM_206696.1  CG1522-RC, transcript variant C (cac), mRNA 
0   14  NM_078578.2  CG1522-RA, transcript variant A (cac), mRNA 
0   14  NM_001014734.1  CG1522-RH, transcript variant H (cac), mRNA 
0   14  NM_001014733.1  CG1522-RI, transcript variant I (cac), mRNA 
0   14  NM_206694.1  CG1522-RE, transcript variant E (cac), mRNA 
0   14  NM_206695.1  CG1522-RD, transcript variant D (cac), mRNA 
0   14  NM_001014735.1  CG1522-RG, transcript variant G (cac), mRNA 
0   14  NM_001014732.1  CG1522-RJ, transcript variant J (cac), mRNA 
0   14  NM_206693.1  CG1522-RF, transcript variant F (cac), mRNA 
0   14  NM_206697.1  CG1522-RB, transcript variant B (cac), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
 
DC
 
DM
 
VM
 
VB
 
Caspase-3 signal
N
++ 
DB
DC
DM
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.