National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31299R-6 
 Symbol nocturnin  Full Name nocturnin 
 CG No CG31299  Old CG No CG31299 
 Synonyms CG4796, CG4782, CG31299, nocturnin, nocturin, Dnocturnin 
 Accession No (Link to NCBI) NM_169374.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees semi-lethal 
 Map Viewer
 Reference
[Please submit your publication]
Nagoshi E, Sugino K, Kula E, Okazaki E, Tachibana T, Nelson S, Rosbash M.
Dissecting differential gene expression within the circadian neuronal circuit of Drosophila.
Nat. Neurosci. (2010) 13(1) 60-8 [ PubMed ID = 19966839 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTTGGGCAAGGCCATGCCAGT 
 Primer Seq. 3'
aatctagaggtaccCGCCCAGCTGTTCGTCCATTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CTTGGGCAAG GcCATGCCAG TGACAGCTCT TTTGCTGAAT TTGGAGTCAA ATCCTTTGGA 
0061 TTACAGTAGG AATGACATTG GAGCTGAGCT CCTNGAAGAT GATGACAAGC CACCGCAATT 
0121 GTTTAGCGTT ACGGATGAGC CACCCTCGCC CAACGAAGAG GATTACAAGC CACCCAATCA 
0181 CCATGAGGAT GATGGAAAAC TGGCTGGTGA ACGGCACAGG GAGATACCCT GTTCGAATTG 
0241 CCTGAAAACG GCACCTGGCC ATCTGATCGA TCGCCAGTCG GCCATCAATG AGATGTGCCA 
0301 GCGCCTGTGT GGTCCCGAAT GCAGACGTCC ACAAGGTCTC ACATTGGATG GTGTGCGTCA 
0361 GGATTTCCTC AGGCAGTACG AAATCGCGGA AGCTGTGGCC AAGACCTCGG CCATGACCTC 
0421 CACCGTTCAG ATGANAcagc gNCNGGCGGC GCGAAAACTG GAATTCGAAA AGGAAATGGA 
0481 AATGGACGAA CAGCTGNGCG  
 in silico PCR Fragment
0001 CTTGGGCAAG GCCATGCCAG TGACAGCTCT TTTGCTGAAT TTGGAGTCAA ATCCTTTGGA 
0061 TTACAGTAGG AATGACATTG GAGCTGAGCT CCTCGAAGAT GATGACAAGC CACCGCAATT 
0121 GTTTAGCGTT ACGGATGAGC CACCCTCGCC CAACGAAGAG GATTACAAGC CACCCAATCA 
0181 CCATGAGGAT GATGGAAAAC TGGCTGGTGA ACGGCACAGG GAGATACCCT GTTCGAATTG 
0241 CCTGAAAACG GCACCTGGCC ATCTGATCGA TCGCCAGTCG GCCATCAATG AGATGTGCCA 
0301 GCGCCTGTGT GGTCCCGAAT GCAGACGTCC ACAAGGTCTC ACATTGGATG GTGTGCGTCA 
0361 GGATTTCCTC AGGCAGTACG AAATCGCGGA AGCTGTGGCC AAGACCTCGG CCATGACCTC 
0421 CACCGTTCAG ATGAAACAGC GCCTGGCGGC GCGAAAACTG GAATTCGAAA AGGAAATGGA 
0481 AATGGACGAA CAGCTGGGCG  
 Assemble Data

31299R-6.IR_full       1   CTTGGGCAAGGCCATGCCAGTGACAGCTCTTTTGCTGAATTTGGAGTCAAATCCTTTGGA 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31299R-6.in silico     1   CTTGGGCAAGGCCATGCCAGTGACAGCTCTTTTGCTGAATTTGGAGTCAAATCCTTTGGA 60


31299R-6.IR_full       61  TTACAGTAGGAATGACATTGGAGCTGAGCTCCTNGAAGATGATGACAAGCCACCGCAATT 120
                           ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||
31299R-6.in silico     61  TTACAGTAGGAATGACATTGGAGCTGAGCTCCTCGAAGATGATGACAAGCCACCGCAATT 120


31299R-6.IR_full       121 GTTTAGCGTTACGGATGAGCCACCCTCGCCCAACGAAGAGGATTACAAGCCACCCAATCA 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31299R-6.in silico     121 GTTTAGCGTTACGGATGAGCCACCCTCGCCCAACGAAGAGGATTACAAGCCACCCAATCA 180


31299R-6.IR_full       181 CCATGAGGATGATGGAAAACTGGCTGGTGAACGGCACAGGGAGATACCCTGTTCGAATTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31299R-6.in silico     181 CCATGAGGATGATGGAAAACTGGCTGGTGAACGGCACAGGGAGATACCCTGTTCGAATTG 240


31299R-6.IR_full       241 CCTGAAAACGGCACCTGGCCATCTGATCGATCGCCAGTCGGCCATCAATGAGATGTGCCA 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31299R-6.in silico     241 CCTGAAAACGGCACCTGGCCATCTGATCGATCGCCAGTCGGCCATCAATGAGATGTGCCA 300


31299R-6.IR_full       301 GCGCCTGTGTGGTCCCGAATGCAGACGTCCACAAGGTCTCACATTGGATGGTGTGCGTCA 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31299R-6.in silico     301 GCGCCTGTGTGGTCCCGAATGCAGACGTCCACAAGGTCTCACATTGGATGGTGTGCGTCA 360


31299R-6.IR_full       361 GGATTTCCTCAGGCAGTACGAAATCGCGGAAGCTGTGGCCAAGACCTCGGCCATGACCTC 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31299R-6.in silico     361 GGATTTCCTCAGGCAGTACGAAATCGCGGAAGCTGTGGCCAAGACCTCGGCCATGACCTC 420


31299R-6.IR_full       421 CACCGTTCAGATGANACAGCGNCNGGCGGCGCGAAAACTGGAATTCGAAAAGGAAATGGA 480
                           |||||||||||||| |||||| | ||||||||||||||||||||||||||||||||||||
31299R-6.in silico     421 CACCGTTCAGATGAAACAGCGCCTGGCGGCGCGAAAACTGGAATTCGAAAAGGAAATGGA 480


31299R-6.IR_full       481 AATGGACGAACAGCTGNGCG 500
                           |||||||||||||||| |||
31299R-6.in silico     481 AATGGACGAACAGCTGGGCG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169374.1  CG31299-RA, transcript variant A (nocturnin), mRNA 
0   NM_137207.2  CG8207-RA (CG8207), mRNA 
0   NM_168587.1  CG17697-RB, transcript variant B (fz), mRNA 
0   10  NM_001032233.1  CG13203-RB, transcript variant B (CG13203), mRNA 
0   NM_078580.2  CG1502-RA (tsg), mRNA 
0   NM_142895.1  CG10170-RA (CG10170), mRNA 
0   NM_141512.2  CG7891-RA (CG7891), mRNA 
0   NM_168367.1  CG32046-RA, transcript variant A (CG32046), mRNA 
0   NM_168366.2  CG32046-RB, transcript variant B (CG32046), mRNA 
0   NM_136237.2  CG9265-RA (CG9265), mRNA 
0   NM_137447.2  CG5098-RA (CG5098), mRNA 
0   NM_137110.2  CG8617-RA (CG8617), mRNA 
0   NM_135670.1  CG4988-RA (CG4988), mRNA 
0   11  NM_137951.1  CG5357-RA (CG5357), mRNA 
0   NM_165009.1  CG31763-RA (CG31763), mRNA 
0   NM_080214.2  CG10913-RA (Spn6), mRNA 
0   NM_132860.2  CG15916-RA (CG15916), mRNA 
0   NM_168578.1  CG17285-RB, transcript variant B (Fbp1), mRNA 
0   NM_079341.1  CG17285-RA, transcript variant A (Fbp1), mRNA 
0   NM_169059.1  CG2902-RA (Nmdar1), mRNA 
0   NM_167335.1  CG4013-RC, transcript variant C (Smr), mRNA 
0   NM_167334.1  CG4013-RB, transcript variant B (Smr), mRNA 
0   NM_080536.2  CG4013-RA, transcript variant A (Smr), mRNA 
0   19  NM_078575.2  CG9355-RA (dy), mRNA 
0   26  NM_175960.3  CG33196-RB (dp), mRNA 
0   NM_078525.2  CG10961-RA (Traf2), mRNA 
0   NM_165794.2  CG11895-RA (stan), mRNA 
0   NM_140116.2  CG8104-RA (nudE), mRNA 
0   NM_206175.2  CG8201-RF, transcript variant F (par-1), mRNA 
0   NM_206173.2  CG8201-RC, transcript variant C (par-1), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.