National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  

Suspension of shipments during Golden Week Holidays: From 30 April to 14 May, deadline 17 April.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31237R-1 
 Symbol Rpb4  Full Name Rpb4 
 CG No CG33520  Old CG No CG31237 
 Synonyms Ada2a/Rpb4, RPB4, CG7150, Ada2a, dRpb4, dAda2a, ADA2A, dAda2A, ADA2a, CG31237, CG31318, CG33520, Ada2A, anon-WO0118547.402, Rpb4 
 Accession No (Link to NCBI) NM_001014635.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev Biol (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Pankotai T, Ujfaludi Z, VĂ¡mos E, Suri K, Boros IM.
The dissociable RPB4 subunit of RNA Pol II has vital functions in Drosophila.
Mol Genet Genomics (2010) 283(1) 89-97 [ PubMed ID = 19921261 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TCAGAGTTCGAAAATGCCGAGACGCTGCTGATATCGGAGGTGCACATGCTTCTCGATCAC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CGAAAGCGACAAAACGAATCCGCCGACGAGGAGCAAGAGTTCTCCGAGGTCTTCATGAAG 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ACGTACGCCTACACGGATAGTTTTCGAAAGTTCAAAAACAAGGAGACCATAATGTCTGCG 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CGAAGCTTGCTGATGCAGAAAAAGCTGCACAAATTCGAACTGGCGGCACTGGGTAATTTG 240

                           |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| silico     241 TGTCCGGAGGCGCCCGAGGAGGCCAAGGCGCTGATTCCTTCACTAGAGGGTCGCTTCGAG 300

                           ||||||| | |||||||||||||||||||||||||||||||||||||||| silico     301 GATGAGGAGCTGCGCCAAATACTCGACGATATCGGCACTAAACGCAGCTT 350

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   332  NM_001014633.1  CG33520-RD, transcript variant D (Rpb4), mRNA 
100   332  NM_001014636.1  CG33520-RB, transcript variant B (Rpb4), mRNA 
100   332  NM_001014634.1  CG33520-RE, transcript variant E (Rpb4), mRNA 
100   332  NM_001014635.1  CG33520-RA, transcript variant A (Rpb4), mRNA 
100   332  NM_001014637.1  CG33520-RC, transcript variant C (Rpb4), mRNA 
0   NM_141115.1  CG14562-RA (CG14562), mRNA 
0   NM_141811.2  CG5252-RA (Ranbp9), mRNA 
0   NM_134481.1  CG14220-RA (CG14220), mRNA 
0   NM_164436.1  CG17646-RB, transcript variant B (CG17646), mRNA 
0   NM_134774.2  CG17646-RA, transcript variant A (CG17646), mRNA 
0   NM_169497.1  CG8476-RA (CG8476), mRNA 
0   NM_143028.1  CG13634-RA (CG13634), mRNA 
0   NM_169701.2  CG31045-RB, transcript variant B (Mhcl), mRNA 
0   NM_001043250.1  CG31045-RG, transcript variant G (Mhcl), mRNA 
0   NM_169700.2  CG31045-RA, transcript variant A (Mhcl), mRNA 
0   NM_141397.2  CG1021-RB, transcript variant B (CG1021), mRNA 
0   NM_169141.1  CG1021-RA, transcript variant A (CG1021), mRNA 
0   NM_078869.4  CG15154-RB, transcript variant B (Socs36E), mRNA 
0   NM_165243.1  CG15154-RA, transcript variant A (Socs36E), mRNA 
0   NM_141430.2  CG1988-RA, transcript variant A (CG1988), mRNA 
0   NM_176414.1  CG1988-RB, transcript variant B (CG1988), mRNA 
0   NM_142377.1  CG18139-RA (CG18139), mRNA 
0   NM_143421.2  CG11897-RB, transcript variant B (CG11897), mRNA 
0   NM_079714.2  CG6706-RB, transcript variant B (GABA-B-R2), mRNA 
0   NM_169968.1  CG6706-RA, transcript variant A (GABA-B-R2), mRNA 
0   NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_144365.2  CG17200-RA (Ugt86Dg), mRNA 
0   NM_137740.2  CG9841-RA (EfSec), mRNA 
0   NM_079576.1  CG12809-RA (nerfin-2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.