National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31237R-1 
 Symbol Rpb4  Full Name Rpb4 
 CG No CG33520  Old CG No CG31237 
 Synonyms Ada2a/Rpb4, RPB4, CG7150, Ada2a, dRpb4, dAda2a, ADA2A, dAda2A, ADA2a, CG31237, CG31318, CG33520, Ada2A, anon-WO0118547.402, Rpb4 
 Accession No (Link to NCBI) NM_001014635.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Pankotai T, Ujfaludi Z, VĂ¡mos E, Suri K, Boros IM.
The dissociable RPB4 subunit of RNA Pol II has vital functions in Drosophila.
Mol. Genet. Genomics (2010) 283(1) 89-97 [ PubMed ID = 19921261 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCAGAGTTCGAAAATGCCGAG 
 Primer Seq. 3'
aatctagaggtaccAAGCTGCGTTTAGTGCCGATA 
 Predicted Fragment Size
350 
 IR fragment full Seq
0001 TCAGAGTTCG AAAATGCCGA GACGCTGCTG ATATCGGAGG TGCACATGCT TCTCGATCAC 
0061 CGAAAGCGAC AAAACGAATC CGCCGACGAG GAGCAAGAGT TCTCCGAGGT CTTCATGAAG 
0121 ACGTACGCCT ACACGGATAG TTTTCGAAAG TTCAAAAACA AGGAGACCAT AATGTCTGCG 
0181 CGAAGCTTGC TGATGCAGAA AAAGCTGCAC AAATTCGAAC TGGCGGCACT GGGTAATTTG 
0241 TGTCCGGAGG CGCCCGAGGA gGNCAAGGCG CTGATTCCTT CACTAGAGGG TCGCTTCGAG 
0301 GATGAgGNGN TGCGCCAAAT ACTCGACGAT ATCGGCACTA AACGCAGCTT  
 in silico PCR Fragment
0001 TCAGAGTTCG AAAATGCCGA GACGCTGCTG ATATCGGAGG TGCACATGCT TCTCGATCAC 
0061 CGAAAGCGAC AAAACGAATC CGCCGACGAG GAGCAAGAGT TCTCCGAGGT CTTCATGAAG 
0121 ACGTACGCCT ACACGGATAG TTTTCGAAAG TTCAAAAACA AGGAGACCAT AATGTCTGCG 
0181 CGAAGCTTGC TGATGCAGAA AAAGCTGCAC AAATTCGAAC TGGCGGCACT GGGTAATTTG 
0241 TGTCCGGAGG CGCCCGAGGA GGCCAAGGCG CTGATTCCTT CACTAGAGGG TCGCTTCGAG 
0301 GATGAGGAGC TGCGCCAAAT ACTCGACGAT ATCGGCACTA AACGCAGCTT  
 Assemble Data

31237R-1.IR_full       1   TCAGAGTTCGAAAATGCCGAGACGCTGCTGATATCGGAGGTGCACATGCTTCTCGATCAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31237R-1.in silico     1   TCAGAGTTCGAAAATGCCGAGACGCTGCTGATATCGGAGGTGCACATGCTTCTCGATCAC 60


31237R-1.IR_full       61  CGAAAGCGACAAAACGAATCCGCCGACGAGGAGCAAGAGTTCTCCGAGGTCTTCATGAAG 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31237R-1.in silico     61  CGAAAGCGACAAAACGAATCCGCCGACGAGGAGCAAGAGTTCTCCGAGGTCTTCATGAAG 120


31237R-1.IR_full       121 ACGTACGCCTACACGGATAGTTTTCGAAAGTTCAAAAACAAGGAGACCATAATGTCTGCG 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31237R-1.in silico     121 ACGTACGCCTACACGGATAGTTTTCGAAAGTTCAAAAACAAGGAGACCATAATGTCTGCG 180


31237R-1.IR_full       181 CGAAGCTTGCTGATGCAGAAAAAGCTGCACAAATTCGAACTGGCGGCACTGGGTAATTTG 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31237R-1.in silico     181 CGAAGCTTGCTGATGCAGAAAAAGCTGCACAAATTCGAACTGGCGGCACTGGGTAATTTG 240


31237R-1.IR_full       241 TGTCCGGAGGCGCCCGAGGAGGNCAAGGCGCTGATTCCTTCACTAGAGGGTCGCTTCGAG 300
                           |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||
31237R-1.in silico     241 TGTCCGGAGGCGCCCGAGGAGGCCAAGGCGCTGATTCCTTCACTAGAGGGTCGCTTCGAG 300


31237R-1.IR_full       301 GATGAGGNGNTGCGCCAAATACTCGACGATATCGGCACTAAACGCAGCTT 350
                           ||||||| | ||||||||||||||||||||||||||||||||||||||||
31237R-1.in silico     301 GATGAGGAGCTGCGCCAAATACTCGACGATATCGGCACTAAACGCAGCTT 350

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   332  NM_001014633.1  CG33520-RD, transcript variant D (Rpb4), mRNA 
100   332  NM_001014636.1  CG33520-RB, transcript variant B (Rpb4), mRNA 
100   332  NM_001014634.1  CG33520-RE, transcript variant E (Rpb4), mRNA 
100   332  NM_001014635.1  CG33520-RA, transcript variant A (Rpb4), mRNA 
100   332  NM_001014637.1  CG33520-RC, transcript variant C (Rpb4), mRNA 
0   NM_141115.1  CG14562-RA (CG14562), mRNA 
0   NM_141811.2  CG5252-RA (Ranbp9), mRNA 
0   NM_134481.1  CG14220-RA (CG14220), mRNA 
0   NM_164436.1  CG17646-RB, transcript variant B (CG17646), mRNA 
0   NM_134774.2  CG17646-RA, transcript variant A (CG17646), mRNA 
0   NM_169497.1  CG8476-RA (CG8476), mRNA 
0   NM_143028.1  CG13634-RA (CG13634), mRNA 
0   NM_169701.2  CG31045-RB, transcript variant B (Mhcl), mRNA 
0   NM_001043250.1  CG31045-RG, transcript variant G (Mhcl), mRNA 
0   NM_169700.2  CG31045-RA, transcript variant A (Mhcl), mRNA 
0   NM_141397.2  CG1021-RB, transcript variant B (CG1021), mRNA 
0   NM_169141.1  CG1021-RA, transcript variant A (CG1021), mRNA 
0   NM_078869.4  CG15154-RB, transcript variant B (Socs36E), mRNA 
0   NM_165243.1  CG15154-RA, transcript variant A (Socs36E), mRNA 
0   NM_141430.2  CG1988-RA, transcript variant A (CG1988), mRNA 
0   NM_176414.1  CG1988-RB, transcript variant B (CG1988), mRNA 
0   NM_142377.1  CG18139-RA (CG18139), mRNA 
0   NM_143421.2  CG11897-RB, transcript variant B (CG11897), mRNA 
0   NM_079714.2  CG6706-RB, transcript variant B (GABA-B-R2), mRNA 
0   NM_169968.1  CG6706-RA, transcript variant A (GABA-B-R2), mRNA 
0   NM_176556.1  CG33106-RA, transcript variant A (mask), mRNA 
0   NM_176557.1  CG33106-RB, transcript variant B (mask), mRNA 
0   NM_144365.2  CG17200-RA (Ugt86Dg), mRNA 
0   NM_137740.2  CG9841-RA (EfSec), mRNA 
0   NM_079576.1  CG12809-RA (nerfin-2), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.