National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31196R-4 
 Symbol 14-3-3epsilon  Full Name 14-3-3epsilon 
 CG No CG31196  Old CG No CG31196 
 Synonyms PAR5, 14-3-3, par-5, Par-5, D14-3-3epsilon, D14-3-3e, 14-3-3-e, 14-3-3e, EK3-5, CT24092, 14-3-3epsilon, d14-3-3epsilon, SR3-9, l(3)j2B10, Su(Raf)3B, CG31196, anon-WO02059370.52, anon-WO0172774.141 
 Accession No (Link to NCBI) NM_169796.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Karam CS, Kellner WA, Takenaka N, Clemmons AW, Corces VG.
14-3-3 mediates histone cross-talk during transcription elongation in Drosophila.
PLoS Genet. (2010) 6(6) e1000975 [ PubMed ID = 20532201 ] [ RRC reference ]

Le TP, Vuong LT, Kim AR, Hsu YC, Choi KW.
14-3-3 proteins regulate Tctp-Rheb interaction for organ growth in Drosophila.
Nat Commun (2016) 7 11501 [ PubMed ID = 27151460 ] [ RRC reference ]

Fukui A, Inaki M, Tonoe G, Hamatani H, Homma M, Morimoto T, Aburatani H, Nose A.
Lola regulates glutamate receptor expression at the Drosophila neuromuscular junction.
Biol Open (2012) 1(4) 362-75 [ PubMed ID = 23213426 ] [ RRC reference ]

Tsai CR, Anderson AE, Burra S, Jo J, Galko MJ.
Yorkie regulates epidermal wound healing in Drosophila larvae independently of cell proliferation and apoptosis.
Dev. Biol. (2017) 427(1) 61-71 [ PubMed ID = 28514643 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AATGGTGGAGGCCATGAAGAAGGTCGCCTCCATGGACGTAGAGCTGACCGTCGAGGAGCG 60

                           |||||||||||||||||||||||||||||||||||||||||| |||| |||||| ||||| silico     61  AAATCTGCTGTCGGTGGCGTACAAGAATGTGATTGGAGCACG-CCGT-GCCTCG-TGGCG 120

                           ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| silico     121 CATCATCACCTCGATCGAACAGAAGGAGGAGAACAAGGGGG-CCGAGGAGAAATTGGAGA 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 TGATCAAAACCTACCGCGGACAGGTGGAGAAGGAGCTGCGCGACATCTGCTCGGATATAC 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 TGAACGTGCTCGAGAAGCATCTCATTCCATGCGCCACATCCGGCGAAAGCAAAGTATTCT 300

                           |||||||||||||||||||||||||||||||||||||||||||   |||||||||||||| silico     301 ACTATAAGATGAAGGGCGACTACCATCGCTACCTGGCCGAATTCGCCACCGGCTCCGACC 360

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GCAAGGATGCGGCAGAGAACTCGCTGATTGCCTACAAGGCGGCCAGCGATATTGCCATGA 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 ACGATCTGCCACCAACACACCCCATCCGTTTGGGCTTGGCATTGAACTTCTCGGTGTTCT 480

31196R-4.IR_full       481 ACTATGAGATTCTCAACTCGCCG 503
                           ||||||||||||||||||||||| silico     481 ACTATGAGATTCTCAACTCGCCG 503

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   481  NM_169796.1  CG31196-RA, transcript variant A (14-3-3epsilon), mRNA 
100   481  NM_169797.1  CG31196-RB, transcript variant B (14-3-3epsilon), mRNA 
100   481  NM_169798.1  CG31196-RD, transcript variant D (14-3-3epsilon), mRNA 
100   481  NM_169799.1  CG31196-RC, transcript variant C (14-3-3epsilon), mRNA 
0   NM_140068.2  CG3428-RA (CG3428), mRNA 
0   22  36  NM_001014516.1  CG17870-RI, transcript variant I (14-3-3zeta), mRNA 
0   22  36  NM_165741.2  CG17870-RA, transcript variant A (14-3-3zeta), mRNA 
0   22  36  NM_001014515.1  CG17870-RJ, transcript variant J (14-3-3zeta), mRNA 
0   22  36  NM_057537.3  CG17870-RD, transcript variant D (14-3-3zeta), mRNA 
0   22  36  NM_165745.2  CG17870-RG, transcript variant G (14-3-3zeta), mRNA 
0   22  36  NM_206070.1  CG17870-RH, transcript variant H (14-3-3zeta), mRNA 
0   22  36  NM_165740.2  CG17870-RE, transcript variant E (14-3-3zeta), mRNA 
0   22  36  NM_165742.1  CG17870-RB, transcript variant B (14-3-3zeta), mRNA 
0   NM_205934.1  CG13391-RB, transcript variant B (Aats-ala), mRNA 
0   NM_078787.2  CG13391-RA, transcript variant A (Aats-ala), mRNA 
0   NM_142668.2  CG3822-RA (CG3822), mRNA 
0   NM_078867.2  CG5526-RA (Dhc36C), mRNA 
0   NM_167364.1  CG15747-RA (CG15747), mRNA 
0   21  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   13  NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_206012.1  CG33322-RA (CG33322), mRNA 
0   NM_140400.1  CG10083-RA (CG10083), mRNA 
0   NM_134486.1  CG14221-RA (CG14221), mRNA 
0   NM_080021.2  CG2952-RA (Dox-A3), mRNA 
0   NM_058091.3  CG3152-RA (Trap1), mRNA 
0   NM_001038808.1  CG17140-RA, transcript variant A (CG17140), mRNA 
0   NM_001038809.1  CG17139-RA, transcript variant A (CG17139), mRNA 
0   14  NM_001043251.1  CG31045-RF, transcript variant F (Mhcl), mRNA 
0   14  NM_169701.2  CG31045-RB, transcript variant B (Mhcl), mRNA 
0   14  NM_169700.2  CG31045-RA, transcript variant A (Mhcl), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.