National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 31034R-1 
 Symbol Jon99Cii  Full Name Jonah 99Cii 
 CG No CG31034  Old CG No CG31034 
 Synonyms CG31034, Ser99Da, 99Calpha, Jon99Cbeta, Jon99Calpha, Jon99Cbetaii, Jon99Calphai, SP122, SER1, Ser5, Ser1, Serl, Jon99C1, Jon99C2, Jon99C, CG7877, JonC, Jon99B, Jon99Cii 
 Accession No (Link to NCBI) NM_079830.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr Biol (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGACGCCCATCAAGGACATTCA 
 Primer Seq. 3'
aatctagaggtaccAGGTGCGGCTGCAATCACTTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GACGCCCATC AAGGACATTC AGGGTCGCAT CACCAAACGG CTACCCAGCC TACGAGGGCA 
0061 AGGTGCCCTA CATCGTGGGT CTGCTCTTCA GCGGCAACGG AAACTGGTGG TGCGGTGGCT 
0121 CGATCATCGG CAACACCTGG GTCCTGACCG CCGCTCACTG CACCAACGGA GCCAGTGGAG 
0181 TGACCATCAA CTACGGAGCC AGCATCCGCA CCCAGCCCCA GTACAcCCAC TGGGTGGGCA 
0241 GTGGCGACAT CATCCAGCAC CACCACTACA ACAGCGGCAA CCTGCACAAC GACATCTCCC 
0301 TGATCCGTAC CCCGCACGTC GACTTCTGGA GCCTGGTCAA CAAGGTTGAG CTGCCCAGCT 
0361 ACAACGACCG CTACCAgGAC TACGCCGGAT GGTgGGCCGT GGcCTCCGGA TGGGGCGGCA 
0421 CCTACGATgG CAGCCCACTG CCCGACTGGC TCCAGTCCGT CGATGTCCAG ATCATTTCCC 
0481 AAAGTGATTG CAgNCGCACC T 
 in silico PCR Fragment
0001 GACGCCCATC AAGGACATTC AGGGTCGCAT CACC-AACGG CTACCCAGCC TACGAGGGCA 
0061 AGGTGCCCTA CATCGTGGGT CTGCTCTTCA GCGGCAACGG AAACTGGTGG TGCGGTGGCT 
0121 CGATCATCGG CAACACCTGG GTCCTGACCG CCGCCCACTG CACCAACGGA GCCAGTGGAG 
0181 TGACCATCAA CTACGGAGCC AGCATCCGCA CCCAGCCCCA GTACACCCAC TGGGTGGGCA 
0241 GTGGCGACAT CATCCAGCAC CACCACTACA ACAGCGGCAA CCTGCACAAC GACATCTCCC 
0301 TGATCCGTAC CCCGCACGTC GACTTCTGGA GCCTGGTCAA CAAGGTTGAG CTGCCCAGCT 
0361 ACAACGACCG CTACCAGGAC TACGCCGGAT GGTGGGCCGT GGCCTCCGGA TGGGGCGGCA 
0421 CCTACGATGG CAGCCCACTG CCCGACTGGC TCCAGTCCGT CGATGTCCAG ATCATTTCCC 
0481 AAAGTGATTG CAGCCGCACC T 
 Assemble Data

31034R-1.IR_full       1   GACGCCCATCAAGGACATTCAGGGTCGCATCACCAAACGGCTACCCAGCCTACGAGGGCA 60
                           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
31034R-1.in silico     1   GACGCCCATCAAGGACATTCAGGGTCGCATCACC-AACGGCTACCCAGCCTACGAGGGCA 60


31034R-1.IR_full       61  AGGTGCCCTACATCGTGGGTCTGCTCTTCAGCGGCAACGGAAACTGGTGGTGCGGTGGCT 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31034R-1.in silico     61  AGGTGCCCTACATCGTGGGTCTGCTCTTCAGCGGCAACGGAAACTGGTGGTGCGGTGGCT 120


31034R-1.IR_full       121 CGATCATCGGCAACACCTGGGTCCTGACCGCCGCTCACTGCACCAACGGAGCCAGTGGAG 180
                           |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
31034R-1.in silico     121 CGATCATCGGCAACACCTGGGTCCTGACCGCCGCCCACTGCACCAACGGAGCCAGTGGAG 180


31034R-1.IR_full       181 TGACCATCAACTACGGAGCCAGCATCCGCACCCAGCCCCAGTACACCCACTGGGTGGGCA 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31034R-1.in silico     181 TGACCATCAACTACGGAGCCAGCATCCGCACCCAGCCCCAGTACACCCACTGGGTGGGCA 240


31034R-1.IR_full       241 GTGGCGACATCATCCAGCACCACCACTACAACAGCGGCAACCTGCACAACGACATCTCCC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31034R-1.in silico     241 GTGGCGACATCATCCAGCACCACCACTACAACAGCGGCAACCTGCACAACGACATCTCCC 300


31034R-1.IR_full       301 TGATCCGTACCCCGCACGTCGACTTCTGGAGCCTGGTCAACAAGGTTGAGCTGCCCAGCT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31034R-1.in silico     301 TGATCCGTACCCCGCACGTCGACTTCTGGAGCCTGGTCAACAAGGTTGAGCTGCCCAGCT 360


31034R-1.IR_full       361 ACAACGACCGCTACCAGGACTACGCCGGATGGTGGGCCGTGGCCTCCGGATGGGGCGGCA 420
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31034R-1.in silico     361 ACAACGACCGCTACCAGGACTACGCCGGATGGTGGGCCGTGGCCTCCGGATGGGGCGGCA 420


31034R-1.IR_full       421 CCTACGATGGCAGCCCACTGCCCGACTGGCTCCAGTCCGTCGATGTCCAGATCATTTCCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
31034R-1.in silico     421 CCTACGATGGCAGCCCACTGCCCGACTGGCTCCAGTCCGTCGATGTCCAGATCATTTCCC 480


31034R-1.IR_full       481 AAAGTGATTGCAGNCGCACCT 501
                           ||||||||||||| |||||||
31034R-1.in silico     481 AAAGTGATTGCAGCCGCACCT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_079830.2  CG31034-RA (Jon99Cii), mRNA 
92.11   444  38  NM_170451.2  CG31362-RA (Jon99Ciii), mRNA 
49.37   238  117  69  14  NM_143543.2  CG18030-RA (Jon99Fi), mRNA 
48.13   232  86  92  24  NM_143542.1  CG2229-RA (Jon99Fii), mRNA 
5.6   27  22  57  66  NM_135038.1  CG8869-RA (Jon25Bii), mRNA 
1.65   42  34  74  NM_139960.1  CG7170-RA (Jon66Cii), mRNA 
1.45   33  32  85  NM_168271.1  CG7118-RA (Jon66Ci), mRNA 
1.03   39  51  85  NM_135037.1  CG8871-RA (Jon25Biii), mRNA 
0.82   NM_138066.2  CG15873-RA (CG15873), mRNA 
0.62   39  84  68  NM_165618.1  CG8579-RA (Jon44E), mRNA 
0.62   NM_143287.1  CG5909-RA (CG5909), mRNA 
0.62   NM_137843.2  CG4329-RA, transcript variant A (CG4329), mRNA 
0.62   NM_166537.1  CG4329-RB, transcript variant B (CG4329), mRNA 
0.41   20  38  60  NM_139758.1  CG10475-RA (Jon65Ai), mRNA 
0.41   14  20  20  NM_079220.1  CG6457-RA (yip7), mRNA 
0.41   32  43  NM_139756.2  CG6483-RA (Jon65Aiii), mRNA 
0.2   20  15  25  NM_139755.2  CG6467-RA (Jon65Aiv), mRNA 
0.2   14  73  92  NM_078753.2  CG8867-RA, transcript variant A (Jon25Bi), mRNA 
0.2   14  73  92  NM_001038784.1  CG8867-RB, transcript variant B (Jon25Bi), mRNA 
0.2   15  37  NM_079831.2  CG31039-RA (Jon99Ci), mRNA 
0.2   10  27  NM_139753.1  CG10477-RA (CG10477), mRNA 
0.2   13  NM_141239.1  CG17735-RA (CG17735), mRNA 
0.2   NM_132921.1  CG9673-RA (CG9673), mRNA 
0   15  29  56  NM_139757.1  CG6580-RA (Jon65Aii), mRNA 
0   24  44  NM_140084.1  CG18180-RA (CG18180), mRNA 
0   NM_166886.1  CG32808-RA (CG32808), mRNA 
0   NM_136265.2  CG17571-RA (CG17571), mRNA 
0   NM_058139.3  CG10033-RA, transcript variant A (for), mRNA 
0   NM_205906.1  CG10033-RH, transcript variant H (for), mRNA 
0   NM_205904.1  CG10033-RI, transcript variant I (for), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.