National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3093R-4 
 Symbol dor  Full Name deep orange 
 CG No CG3093  Old CG No CG3093 
 Synonyms dor, Deep-orange, Dor, EG:171E4.1, CG3093, l(1)7, dor1, unnamed, l(1)76, l(1)2Bw, l(1)2Be 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Lee YM, Sun YH.
Maintenance of glia in the optic lamina is mediated by EGFR signaling by photoreceptors in adult Drosophila.
PLoS Genet. (2015) 11(4) e1005187 [ PubMed ID = 25909451 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgACACGTCTATGCCTAACCAGC 
 Primer Seq. 3'
aatctagaggtaccCGTTATCTCGTGGTCCTTGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

3093R-4.IR full       1   ACACGTCTATGCCTAACCAGCCCAAGTTCCTGCCCCGCATTGAGCATAATTCCTCGGGCG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3093R-4.in silico     1   ACACGTCTATGCCTAACCAGCCCAAGTTCCTGCCCCGCATTGAGCATAATTCCTCGGGCG 60


3093R-4.IR full       61  CTACCGCCAACTCCTACGTGGCCACCGCC-CCGGCAATCCCTTCGAAACGGACGAGGAGG 120
                          ||||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||
3093R-4.in silico     61  CTACCGCCAACTCCTACGTGGCCACCGCCTCCGGCAATCCCTTCGAAACGGACGATGAGG 120


3093R-4.IR full       121 ATGAAATCTTCAGCAGACACAAGATGGTGCTCCGGGTGCCCAGCAACTGCACCGGCGACC 180
                          |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||
3093R-4.in silico     121 ATGAAATCTTCAGCAGGCACAAGATGGTGCTCCGGGTGCCCAGCAACTGCACCGGCGACC 180


3093R-4.IR full       181 TGATGCACCTGGCCGTCTCGCGGAATTGGCTCGTCTGCCTGTTGGGCACGCCGGAGCGGA 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3093R-4.in silico     181 TGATGCACCTGGCCGTCTCGCGGAATTGGCTCGTCTGCCTGTTGGGCACGCCGGAGCGGA 240


3093R-4.IR full       241 CAACTCTGCTGCGCTTCTTCCTGCCTCGCGCGATTCCACCGGGAGAAGCGGTGCTGGAAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3093R-4.in silico     241 CAACTCTGCTGCGCTTCTTCCTGCCTCGCGCGATTCCACCGGGAGAAGCGGTGCTGGAAA 300


3093R-4.IR full       301 AGTACCTCTCTGGNTCCGGCTATAAAATAACACGCATGTTCCTGGACCCCACGGGCCATC 360
                          ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||
3093R-4.in silico     301 AGTACCTCTCTGGCTCCGGCTATAAAATAACACGCATGTTCCTGGACCCCACGGGCCATC 360


3093R-4.IR full       361 ACATCATTATCGCACTGGTGCCAAAGNNCGCTACCGCTGGTGTCTCTCCGGACTTNCTGT 420
                          ||||||||||||||||||||||||||  ||||||||||||||||||||||||||| ||||
3093R-4.in silico     361 ACATCATTATCGCACTGGTGCCAAAGTCCGCTACCGCTGGTGTCTCTCCGGACTTTCTGT 420


3093R-4.IR full       421 ACATCCACTGCCTCGAN--GNCCCAGGCGCAACAGCTGAAGGTGCGGCGCATCGAGAAGT 480
                          ||||||||||||||||   | |||||||||||||||||||||||||||||||||||||||
3093R-4.in silico     421 ACATCCACTGCCTCGAGTCGCCCCAGGCGCAACAGCTGAAGGTGCGGCGCATCGAGAAGT 480


3093R-4.IR full       481 TCAAGGACCACGAGATAACG 500
                          ||||||||||||||||||||
3093R-4.in silico     481 TCAAGGACCACGAGATAACG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.