National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3069R-2 
 Symbol Taf10b  Full Name TBP-associated factor 10b 
 CG No CG3069  Old CG No CG3069 
 Synonyms dTAF[[II]]16, dmTAF10b, TAF, TFIID, TAF[[II]], TAF[[II]]16, TAF10b, CG3069, dtafII16, TAFII16, TafII16, Taf16, Taf10b 
 Accession No (Link to NCBI) NM_058070.4 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TGGCGCAAGCAG-TCATGGACAATCCTCGGGAGGAGGTGGCGGTGGAGATCGGGATAGGA 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCACACCATCTTCGCATCTCAGCGACTTCATGTCGCAGCTGGAAGATTATACTCCATTGA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | silico     121 TTCCGGATGCGGTCACCTCGCACTATCTCAACATGGGAGGCTTTCAGTCGGACGACAA-G 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CGCATCGTTCGGCTGATCAGCCTAGCCGCCCAGAAGTACATGTCCGACATCATCGACGAT 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GCACTGCAGCACTCCAAGGCGCGCACCCATATGCAAACCACCAATACACCGGGAGGATCG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| silico     301 AAGGCCAAGGACCGCAAGTTCACCTTGACCATGGAGGATCTGCAGCCGGC-TTTGGCCGA 360

3069R-2.IR_full       361 CTACGGTATT 370
                          |||||||||| silico     361 CTACGGTATT 370

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   349  NM_058070.4  CG3069-RA (Taf10b), mRNA 
0.28   NM_168379.1  CG32050-RA (CG32050), mRNA 
0   NM_135786.1  CG6108-RA (CG6108), mRNA 
0   NM_143601.2  CG12114-RA (CG12114), mRNA 
0   15  NM_170420.1  CG18741-RA, transcript variant A (DopR2), mRNA 
0   15  NM_079824.2  CG18741-RB, transcript variant B (DopR2), mRNA 
0   10  NM_001014706.1  CG13376-RA (CG13376), mRNA 
0   NM_143004.1  CG13615-RA (CG13615), mRNA 
0   NM_132226.1  CG1583-RA (CG1583), mRNA 
0   10  18  NM_136816.1  CG13214-RA, transcript variant A (CG13214), mRNA 
0   11  NM_142622.1  CG4360-RA (CG4360), mRNA 
0   NM_131948.1  CG3081-RA (CG3081), mRNA 
0   10  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   NM_141397.2  CG1021-RB, transcript variant B (CG1021), mRNA 
0   NM_169141.1  CG1021-RA, transcript variant A (CG1021), mRNA 
0   NM_078876.4  CG10697-RA, transcript variant A (Ddc), mRNA 
0   NM_165279.1  CG10697-RC, transcript variant C (Ddc), mRNA 
0   NM_165280.1  CG10697-RB, transcript variant B (Ddc), mRNA 
0   NM_136559.2  CG8738-RA (CG8738), mRNA 
0   NM_167160.1  CG1634-RB, transcript variant B (Nrg), mRNA 
0   NM_140559.1  CG17033-RA (CG17033), mRNA 
0   NM_137571.1  CG9416-RA (CG9416), mRNA 
0   NM_176130.3  CG12052-RJ, transcript variant J (lola), mRNA 
0   NM_167380.1  CG32628-RA (CG32628), mRNA 
0   NM_166497.1  CG13499-RA, transcript variant A (CG13499), mRNA 
0   NM_166498.1  CG13499-RC, transcript variant C (CG13499), mRNA 
0   NM_166499.1  CG13499-RD, transcript variant D (CG13499), mRNA 
0   NM_137784.1  CG13499-RB, transcript variant B (CG13499), mRNA 
0   NM_169359.1  CG14685-RC, transcript variant C (Cap-H2), mRNA 
0   NM_078506.2  CG12217-RA (PpV), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.