National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3069R-1 
 Symbol Taf10b  Full Name TBP-associated factor 10b 
 CG No CG3069  Old CG No CG3069 
 Synonyms dTAF[[II]]16, dmTAF10b, TAF, TFIID, TAF[[II]], TAF[[II]]16, TAF10b, CG3069, dtafII16, TAFII16, TafII16, Taf16, Taf10b 
 Accession No (Link to NCBI) NM_058070.4 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTGGCGCAAGCAGTCATGGACA 
 Primer Seq. 3'
aatctagaggtaccAATACCGTAGTCGGCCAAAGC 
 Predicted Fragment Size
367 
 IR fragment full Seq
0001 TGGCGCAAGC AGTTCATGGA CAATCCTCGG GAGGAGGTGG CGGTGGAGAT CGGGATAGGA 
0061 CCACACCATC TTCGCATCTC AGCGACTTCA TGTCGCAGCT GGAAGATTAT ACTCCATTGA 
0121 TTCCGGATGC GGTCACCTCG CACTATCTCA ACATGGGAGG CTTTCAGTCG GACGACAANG 
0181 CGCATCGTTC GGCTGATCAG CCTAGCCGCC CAGAAGTACA TGTCCGACAT CATCGACGAT 
0241 GCACTGCAGC ACTCCAAGGC GCGCACCCAT ATGCAAACCA CCAATACACC GGGAGGATCG 
0301 AAGGCCAAGG ACCGCAAGTT CACCTTGACC ATGGAGGATC TGCAGCCGGC NTTTGGCCGA 
0361 CTACGGTATT  
 in silico PCR Fragment
0001 TGGCGCAAGC AG-TCATGGA CAATCCTCGG GAGGAGGTGG CGGTGGAGAT CGGGATAGGA 
0061 CCACACCATC TTCGCATCTC AGCGACTTCA TGTCGCAGCT GGAAGATTAT ACTCCATTGA 
0121 TTCCGGATGC GGTCACCTCG CACTATCTCA ACATGGGAGG CTTTCAGTCG GACGACAA-G 
0181 CGCATCGTTC GGCTGATCAG CCTAGCCGCC CAGAAGTACA TGTCCGACAT CATCGACGAT 
0241 GCACTGCAGC ACTCCAAGGC GCGCACCCAT ATGCAAACCA CCAATACACC GGGAGGATCG 
0301 AAGGCCAAGG ACCGCAAGTT CACCTTGACC ATGGAGGATC TGCAGCCGGC -TTTGGCCGA 
0361 CTACGGTATT  
 Assemble Data

3069R-1.IR_full       1   TGGCGCAAGCAGTTCATGGACAATCCTCGGGAGGAGGTGGCGGTGGAGATCGGGATAGGA 60
                          |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||
3069R-1.in silico     1   TGGCGCAAGCAG-TCATGGACAATCCTCGGGAGGAGGTGGCGGTGGAGATCGGGATAGGA 60


3069R-1.IR_full       61  CCACACCATCTTCGCATCTCAGCGACTTCATGTCGCAGCTGGAAGATTATACTCCATTGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3069R-1.in silico     61  CCACACCATCTTCGCATCTCAGCGACTTCATGTCGCAGCTGGAAGATTATACTCCATTGA 120


3069R-1.IR_full       121 TTCCGGATGCGGTCACCTCGCACTATCTCAACATGGGAGGCTTTCAGTCGGACGACAANG 180
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
3069R-1.in silico     121 TTCCGGATGCGGTCACCTCGCACTATCTCAACATGGGAGGCTTTCAGTCGGACGACAA-G 180


3069R-1.IR_full       181 CGCATCGTTCGGCTGATCAGCCTAGCCGCCCAGAAGTACATGTCCGACATCATCGACGAT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3069R-1.in silico     181 CGCATCGTTCGGCTGATCAGCCTAGCCGCCCAGAAGTACATGTCCGACATCATCGACGAT 240


3069R-1.IR_full       241 GCACTGCAGCACTCCAAGGCGCGCACCCATATGCAAACCACCAATACACCGGGAGGATCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3069R-1.in silico     241 GCACTGCAGCACTCCAAGGCGCGCACCCATATGCAAACCACCAATACACCGGGAGGATCG 300


3069R-1.IR_full       301 AAGGCCAAGGACCGCAAGTTCACCTTGACCATGGAGGATCTGCAGCCGGCNTTTGGCCGA 360
                          |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||
3069R-1.in silico     301 AAGGCCAAGGACCGCAAGTTCACCTTGACCATGGAGGATCTGCAGCCGGC-TTTGGCCGA 360


3069R-1.IR_full       361 CTACGGTATT 370
                          ||||||||||
3069R-1.in silico     361 CTACGGTATT 370

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   349  NM_058070.4  CG3069-RA (Taf10b), mRNA 
0.28   NM_168379.1  CG32050-RA (CG32050), mRNA 
0   NM_135786.1  CG6108-RA (CG6108), mRNA 
0   NM_143601.2  CG12114-RA (CG12114), mRNA 
0   15  NM_170420.1  CG18741-RA, transcript variant A (DopR2), mRNA 
0   15  NM_079824.2  CG18741-RB, transcript variant B (DopR2), mRNA 
0   10  NM_001014706.1  CG13376-RA (CG13376), mRNA 
0   NM_143004.1  CG13615-RA (CG13615), mRNA 
0   NM_132226.1  CG1583-RA (CG1583), mRNA 
0   10  18  NM_136816.1  CG13214-RA, transcript variant A (CG13214), mRNA 
0   11  NM_142622.1  CG4360-RA (CG4360), mRNA 
0   NM_131948.1  CG3081-RA (CG3081), mRNA 
0   10  NM_132412.1  CG9817-RA (CG9817), mRNA 
0   NM_141397.2  CG1021-RB, transcript variant B (CG1021), mRNA 
0   NM_169141.1  CG1021-RA, transcript variant A (CG1021), mRNA 
0   NM_078876.4  CG10697-RA, transcript variant A (Ddc), mRNA 
0   NM_165279.1  CG10697-RC, transcript variant C (Ddc), mRNA 
0   NM_165280.1  CG10697-RB, transcript variant B (Ddc), mRNA 
0   NM_136559.2  CG8738-RA (CG8738), mRNA 
0   NM_167160.1  CG1634-RB, transcript variant B (Nrg), mRNA 
0   NM_140559.1  CG17033-RA (CG17033), mRNA 
0   NM_137571.1  CG9416-RA (CG9416), mRNA 
0   NM_176130.3  CG12052-RJ, transcript variant J (lola), mRNA 
0   NM_167380.1  CG32628-RA (CG32628), mRNA 
0   NM_166497.1  CG13499-RA, transcript variant A (CG13499), mRNA 
0   NM_166498.1  CG13499-RC, transcript variant C (CG13499), mRNA 
0   NM_166499.1  CG13499-RD, transcript variant D (CG13499), mRNA 
0   NM_137784.1  CG13499-RB, transcript variant B (CG13499), mRNA 
0   NM_169359.1  CG14685-RC, transcript variant C (Cap-H2), mRNA 
0   NM_078506.2  CG12217-RA (PpV), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.