National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3066R-3 
 Symbol Sp7  Full Name Serine protease 7 
 CG No CG3066  Old CG No CG3066 
 Synonyms MP2, CG3066, SP7, proPO-AE, anon-Ryu, Sp7 
 Accession No (Link to NCBI) NM_141477.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   CCCAACCAGAAACAGGGACAATGTTTGTCCATATACGACTGTCAAAGTCTGCTTTCCGTG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATTCAGCAGTCTTATGTCAGCCCGGAGGACAGAACCTTTCTTCGAAACTCACAGTGCCTC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GATGGAGTAGGTCGCCAGCCATATGTTTGCTGTACAAGTGATCGCAGCTTTGGATCCCAG 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 GAGGCCACCTCCGCAGCCCCTCCTCCAACGACTACCAGTTCAAGTTCACGAGGTCAAGAC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GGTCAAGCGGGTCTGGGCAACCTGCTGCCCTCGCCACCCAAGTGCGGGCCCCACTCCTTC 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AGCAATAAGGTCTATAATGGCAACGACACTGCTATTGACGAGTTCAACTGGATGGCACTG 360

                          | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 C-TTGAGTACGTGGATAACAGGGGACGGCGGGAACTCAGTTGCGGTGGCAGTTTGATCAA 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CAATCGTTACGTTCTTACCGCCGCCCATTGCGTCATTGGTGCGGTGGAAACGGAAGTAGG 480

3066R-3.IR_full       481 TCACCTANCTANCGTTCGGTT 501
                          ||||||| ||| ||||||||| silico     481 TCACCTAACTACCGTTCGGTT 501

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   478  NM_206457.1  CG3066-RD, transcript variant D (Sp7), mRNA 
96.23   460  NM_169192.2  CG3066-RC, transcript variant C (Sp7), mRNA 
96.23   460  NM_141477.2  CG3066-RA, transcript variant A (Sp7), mRNA 
96.23   460  NM_169193.1  CG3066-RB, transcript variant B (Sp7), mRNA 
0   NM_167535.1  CG9676-RA (CG9676), mRNA 
0   NM_141193.3  CG1102-RA (MP1), mRNA 
0   NM_079195.2  CG15002-RB (mas), mRNA 
0   NM_057385.4  CG11121-RA (so), mRNA 
0   NM_136421.1  CG1850-RA (CG1850), mRNA 
0   NM_138193.1  CG17180-RA (CG17180), mRNA 
0   NM_136775.2  CG12344-RA (CG12344), mRNA 
0   NM_132922.2  CG4653-RA (CG4653), mRNA 
0   NM_132704.1  CG11071-RA (CG11071), mRNA 
0   NM_170015.1  CG7057-RA, transcript variant A (AP-50), mRNA 
0   NM_142792.3  CG7057-RB, transcript variant B (AP-50), mRNA 
0   NM_079503.2  CG9761-RA (Nep2), mRNA 
0   NM_141762.2  CG14692-RA (CG14692), mRNA 
0   NM_206420.1  CG33291-RA (CG33291), mRNA 
0   NM_141594.1  CG11970-RA (CG11970), mRNA 
0   NM_143314.2  CG5634-RA (dsd), mRNA 
0   NM_137872.2  CG13527-RA (CG13527), mRNA 
0   NM_136265.2  CG17571-RA (CG17571), mRNA 
0   NM_057361.3  CG4316-RA (Sb), mRNA 
0   NM_142346.1  CG5246-RA (CG5246), mRNA 
0   NM_132054.1  CG6048-RA (CG6048), mRNA 
0   NM_057269.2  CG10236-RA (LanA), mRNA 
0   NM_078969.3  CG12385-RA (thetaTry), mRNA 
0   11  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   11  NM_137945.1  CG30414-RA (CG30414), mRNA 
0   NM_141909.2  CG12256-RA (CG12256), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.