National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3066R-1 
 Symbol Sp7  Full Name Serine protease 7 
 CG No CG3066  Old CG No CG3066 
 Synonyms MP2, CG3066, SP7, proPO-AE, anon-Ryu, Sp7 
 Accession No (Link to NCBI) NM_141477.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Kambris Z, Brun S, Jang IH, Nam HJ, Romeo Y, Takahashi K, Lee WJ, Ueda R, Lemaitre B.
Drosophila immunity: a large-scale in vivo RNAi screen identifies five serine proteases required for Toll activation.
Curr. Biol. (2006) 16(8) 808-13 [ PubMed ID = 16631589 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCCCAACCAGAAACAGGGACAA 
 Primer Seq. 3'
aatctagaggtaccAACCGAACGGTAGTTAGGTGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CCCAACCAGA AACAGGGACA ATGTTTGTCC ATATACGACT GTCAAAGTCT GCTTTCCGTG 
0061 ATTCAGCAGT CTTATGTCAG CCCGGAGGAC AGAACCTTTC TTCGAAACTC ACAGTGCCTC 
0121 GATGGAGTAG GTCGCCAGCC ATATGTTTGC TGTACAAGTG ATCGCAGCTT TGGATCCCAG 
0181 GAGGCCACCT CCGCAGCCCC TCCTCCAACG ACTACCAGTT CAAGTTCACG AGGTCAAGAC 
0241 GGTCAAGCGG GTCTGGGCAA CCTGCTGCCC TCGCCACCCA AGTGCGGGCC CCACTCCTTC 
0301 AGCAATAAGG TCTATAATGG CAACGACACT GCTATTGACG AGTTCAACTG GATGGCACTG 
0361 CNTTGAGTAC GTGGATAACA GGGGACGGCG GGAACTCAGT TGCGGTGGCA GTTTGATCAA 
0421 CAATCGTTAC GTTCTTACCG CCGCCCATTG CGTCATTGGT GCGGTGGAAA CGGAAGTAGG 
0481 TCACCTANCT ANCGTTCGGT T 
 in silico PCR Fragment
0001 CCCAACCAGA AACAGGGACA ATGTTTGTCC ATATACGACT GTCAAAGTCT GCTTTCCGTG 
0061 ATTCAGCAGT CTTATGTCAG CCCGGAGGAC AGAACCTTTC TTCGAAACTC ACAGTGCCTC 
0121 GATGGAGTAG GTCGCCAGCC ATATGTTTGC TGTACAAGTG ATCGCAGCTT TGGATCCCAG 
0181 GAGGCCACCT CCGCAGCCCC TCCTCCAACG ACTACCAGTT CAAGTTCACG AGGTCAAGAC 
0241 GGTCAAGCGG GTCTGGGCAA CCTGCTGCCC TCGCCACCCA AGTGCGGGCC CCACTCCTTC 
0301 AGCAATAAGG TCTATAATGG CAACGACACT GCTATTGACG AGTTCAACTG GATGGCACTG 
0361 C-TTGAGTAC GTGGATAACA GGGGACGGCG GGAACTCAGT TGCGGTGGCA GTTTGATCAA 
0421 CAATCGTTAC GTTCTTACCG CCGCCCATTG CGTCATTGGT GCGGTGGAAA CGGAAGTAGG 
0481 TCACCTAACT ACCGTTCGGT T 
 Assemble Data

3066R-1.IR_full       1   CCCAACCAGAAACAGGGACAATGTTTGTCCATATACGACTGTCAAAGTCTGCTTTCCGTG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3066R-1.in silico     1   CCCAACCAGAAACAGGGACAATGTTTGTCCATATACGACTGTCAAAGTCTGCTTTCCGTG 60


3066R-1.IR_full       61  ATTCAGCAGTCTTATGTCAGCCCGGAGGACAGAACCTTTCTTCGAAACTCACAGTGCCTC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3066R-1.in silico     61  ATTCAGCAGTCTTATGTCAGCCCGGAGGACAGAACCTTTCTTCGAAACTCACAGTGCCTC 120


3066R-1.IR_full       121 GATGGAGTAGGTCGCCAGCCATATGTTTGCTGTACAAGTGATCGCAGCTTTGGATCCCAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3066R-1.in silico     121 GATGGAGTAGGTCGCCAGCCATATGTTTGCTGTACAAGTGATCGCAGCTTTGGATCCCAG 180


3066R-1.IR_full       181 GAGGCCACCTCCGCAGCCCCTCCTCCAACGACTACCAGTTCAAGTTCACGAGGTCAAGAC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3066R-1.in silico     181 GAGGCCACCTCCGCAGCCCCTCCTCCAACGACTACCAGTTCAAGTTCACGAGGTCAAGAC 240


3066R-1.IR_full       241 GGTCAAGCGGGTCTGGGCAACCTGCTGCCCTCGCCACCCAAGTGCGGGCCCCACTCCTTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3066R-1.in silico     241 GGTCAAGCGGGTCTGGGCAACCTGCTGCCCTCGCCACCCAAGTGCGGGCCCCACTCCTTC 300


3066R-1.IR_full       301 AGCAATAAGGTCTATAATGGCAACGACACTGCTATTGACGAGTTCAACTGGATGGCACTG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3066R-1.in silico     301 AGCAATAAGGTCTATAATGGCAACGACACTGCTATTGACGAGTTCAACTGGATGGCACTG 360


3066R-1.IR_full       361 CNTTGAGTACGTGGATAACAGGGGACGGCGGGAACTCAGTTGCGGTGGCAGTTTGATCAA 420
                          | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3066R-1.in silico     361 C-TTGAGTACGTGGATAACAGGGGACGGCGGGAACTCAGTTGCGGTGGCAGTTTGATCAA 420


3066R-1.IR_full       421 CAATCGTTACGTTCTTACCGCCGCCCATTGCGTCATTGGTGCGGTGGAAACGGAAGTAGG 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3066R-1.in silico     421 CAATCGTTACGTTCTTACCGCCGCCCATTGCGTCATTGGTGCGGTGGAAACGGAAGTAGG 480


3066R-1.IR_full       481 TCACCTANCTANCGTTCGGTT 501
                          ||||||| ||| |||||||||
3066R-1.in silico     481 TCACCTAACTACCGTTCGGTT 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   478  NM_206457.1  CG3066-RD, transcript variant D (Sp7), mRNA 
96.23   460  NM_169192.2  CG3066-RC, transcript variant C (Sp7), mRNA 
96.23   460  NM_141477.2  CG3066-RA, transcript variant A (Sp7), mRNA 
96.23   460  NM_169193.1  CG3066-RB, transcript variant B (Sp7), mRNA 
0   NM_167535.1  CG9676-RA (CG9676), mRNA 
0   NM_141193.3  CG1102-RA (MP1), mRNA 
0   NM_079195.2  CG15002-RB (mas), mRNA 
0   NM_057385.4  CG11121-RA (so), mRNA 
0   NM_136421.1  CG1850-RA (CG1850), mRNA 
0   NM_138193.1  CG17180-RA (CG17180), mRNA 
0   NM_136775.2  CG12344-RA (CG12344), mRNA 
0   NM_132922.2  CG4653-RA (CG4653), mRNA 
0   NM_132704.1  CG11071-RA (CG11071), mRNA 
0   NM_170015.1  CG7057-RA, transcript variant A (AP-50), mRNA 
0   NM_142792.3  CG7057-RB, transcript variant B (AP-50), mRNA 
0   NM_079503.2  CG9761-RA (Nep2), mRNA 
0   NM_141762.2  CG14692-RA (CG14692), mRNA 
0   NM_206420.1  CG33291-RA (CG33291), mRNA 
0   NM_141594.1  CG11970-RA (CG11970), mRNA 
0   NM_143314.2  CG5634-RA (dsd), mRNA 
0   NM_137872.2  CG13527-RA (CG13527), mRNA 
0   NM_136265.2  CG17571-RA (CG17571), mRNA 
0   NM_057361.3  CG4316-RA (Sb), mRNA 
0   NM_142346.1  CG5246-RA (CG5246), mRNA 
0   NM_132054.1  CG6048-RA (CG6048), mRNA 
0   NM_057269.2  CG10236-RA (LanA), mRNA 
0   NM_078969.3  CG12385-RA (thetaTry), mRNA 
0   11  NM_001038734.1  CG16902-RC (Hr4), mRNA 
0   11  NM_137945.1  CG30414-RA (CG30414), mRNA 
0   NM_141909.2  CG12256-RA (CG12256), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.