National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3060R-3 
 Symbol mr  Full Name morula 
 CG No CG3060  Old CG No CG3060 
 Synonyms APC2/mr, CG3060, mr 
 Accession No (Link to NCBI) NM_138018.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Reim G, Hruzova M, Goetze S, Basler K.
Protection of armadillo/β-Catenin by armless, a novel positive regulator of wingless signaling.
PLoS Biol. (2014) 12(11) e1001988 [ PubMed ID = 25369031 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGCGACTTTGACGCTTTGTG 
 Primer Seq. 3'
aatctagaggtaccTGAAATTGGGTGGCAGTTGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GTGCGACTTT GACgCTTTGT GGGCGGATGT ACTGAGAATC TTTCCGGTTT TGGGTGGAGC 
0061 GAACGCTGTA TCCAATGATC CGGTTGAGGA GAATGTATTC CAAAATGTTC GCCAGCACCT 
0121 GATGATGTTG GGCAGCATAG ACACCTTCGC GGCGGTTGTG GACCTGGAAA TCCAGTCGAC 
0181 TATTCGGAAT GTCCTGGTGC CCAAGTTCTG GAAGCACATC CACGACGGCT TGGTCTCGTC 
0241 TAAATTGCAG GGCTGGATTA ACGACCAAGC TCTGGCCATA GAAGCACTGC CCGATAAGAA 
0301 CGGACTGTTC ACCCAGTTCA TCGACGCCAT CAATGAGCTG CATGACAGCT TTCAGAGCCT 
0361 GATGCAGGTG AAGCCCAGGC TGATCCAGCT AGTTGGAGCT GAGACAAAGC CCACCGCAAA 
0421 GACGGTGAAG CTCATGCAGG AGGAAGGCAT TAAGAACTGC TTAAGGGACT GCTTGCTGGC 
0481 TCAACTGCCA CCCAATTTCA  
 in silico PCR Fragment
0001 GTGCGACTTT GACGCTTTGT GGGCGGATGT ACTGAGAATC TTTCCGGTTT TGGGTGGAGC 
0061 GAACGCTGTA TCCAATGATC CGGTTGAGGA GAATGTATTC CAAAATGTTC GCCAGCACCT 
0121 GATGGTGTTG GGCAGCATAG ACACCTTCGC GGCGGTTGTG GACCTGGAAA TCCAGTCGAC 
0181 TATTCGGAAT GTCCTGGTGC CCAAGTTCTG GAAGCACATC CACGACGGCT TGGTCTCGTC 
0241 TAAATTGCAG GGCTGGATTA ACGACCAAGC TCTGGCCATA GAAGCACTGC CCGATAAGAA 
0301 CGGACTGTTC ACCCAGTTCA TCGACGCCAT CAATGAGCTG CATGACAGCT TTCAGAGCCT 
0361 GATGCAGGTG AAGCCCAGGC TGATCCAGCT AGTTGGAGCT GAGACAAAGC CCACCGCAAA 
0421 GACGGTGAAG CTCATGCAGG AGGAAGGCAT TAAGAACTGC TTAAGGGACT GCTTGCTGGC 
0481 TCAACTGCCA CCCAATTTCA  
 Assemble Data

3060R-3.IR_full       1   GTGCGACTTTGACGCTTTGTGGGCGGATGTACTGAGAATCTTTCCGGTTTTGGGTGGAGC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3060R-3.in silico     1   GTGCGACTTTGACGCTTTGTGGGCGGATGTACTGAGAATCTTTCCGGTTTTGGGTGGAGC 60


3060R-3.IR_full       61  GAACGCTGTATCCAATGATCCGGTTGAGGAGAATGTATTCCAAAATGTTCGCCAGCACCT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3060R-3.in silico     61  GAACGCTGTATCCAATGATCCGGTTGAGGAGAATGTATTCCAAAATGTTCGCCAGCACCT 120


3060R-3.IR_full       121 GATGATGTTGGGCAGCATAGACACCTTCGCGGCGGTTGTGGACCTGGAAATCCAGTCGAC 180
                          |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||
3060R-3.in silico     121 GATGGTGTTGGGCAGCATAGACACCTTCGCGGCGGTTGTGGACCTGGAAATCCAGTCGAC 180


3060R-3.IR_full       181 TATTCGGAATGTCCTGGTGCCCAAGTTCTGGAAGCACATCCACGACGGCTTGGTCTCGTC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3060R-3.in silico     181 TATTCGGAATGTCCTGGTGCCCAAGTTCTGGAAGCACATCCACGACGGCTTGGTCTCGTC 240


3060R-3.IR_full       241 TAAATTGCAGGGCTGGATTAACGACCAAGCTCTGGCCATAGAAGCACTGCCCGATAAGAA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3060R-3.in silico     241 TAAATTGCAGGGCTGGATTAACGACCAAGCTCTGGCCATAGAAGCACTGCCCGATAAGAA 300


3060R-3.IR_full       301 CGGACTGTTCACCCAGTTCATCGACGCCATCAATGAGCTGCATGACAGCTTTCAGAGCCT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3060R-3.in silico     301 CGGACTGTTCACCCAGTTCATCGACGCCATCAATGAGCTGCATGACAGCTTTCAGAGCCT 360


3060R-3.IR_full       361 GATGCAGGTGAAGCCCAGGCTGATCCAGCTAGTTGGAGCTGAGACAAAGCCCACCGCAAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3060R-3.in silico     361 GATGCAGGTGAAGCCCAGGCTGATCCAGCTAGTTGGAGCTGAGACAAAGCCCACCGCAAA 420


3060R-3.IR_full       421 GACGGTGAAGCTCATGCAGGAGGAAGGCATTAAGAACTGCTTAAGGGACTGCTTGCTGGC 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3060R-3.in silico     421 GACGGTGAAGCTCATGCAGGAGGAAGGCATTAAGAACTGCTTAAGGGACTGCTTGCTGGC 480


3060R-3.IR_full       481 TCAACTGCCACCCAATTTCA 500
                          ||||||||||||||||||||
3060R-3.in silico     481 TCAACTGCCACCCAATTTCA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_138018.2  CG3060-RA (mr), mRNA 
0.2   NM_057627.3  CG8996-RB, transcript variant B (wal), mRNA 
0.2   NM_165847.1  CG8996-RA, transcript variant A (wal), mRNA 
0   11  NM_078788.2  CG17797-RA (Acp29AB), mRNA 
0   NM_168999.2  CG9805-RB, transcript variant B (eIF3-S10), mRNA 
0   NM_141213.2  CG9805-RA, transcript variant A (eIF3-S10), mRNA 
0   NM_168386.1  CG8108-RA, transcript variant A (CG8108), mRNA 
0   NM_140110.2  CG8108-RB, transcript variant B (CG8108), mRNA 
0   NM_001015239.1  CG17172-PC.3 (CG17172), mRNA 
0   NM_167035.1  CG4165-RB, transcript variant B (CG4165), mRNA 
0   NM_167037.1  CG4165-RD, transcript variant D (CG4165), mRNA 
0   NM_131992.2  CG4165-RA, transcript variant A (CG4165), mRNA 
0   NM_167036.1  CG4165-RC, transcript variant C (CG4165), mRNA 
0   NM_135019.1  CG15627-RA (CG15627), mRNA 
0   NM_142463.2  CG7678-RA (CG7678), mRNA 
0   NM_167664.1  CG12230-RB, transcript variant B (car), mRNA 
0   NM_078686.2  CG12230-RA, transcript variant A (car), mRNA 
0   NM_144321.1  CG6115-RA (CG6115), mRNA 
0   NM_134964.1  CG3921-RA (CG3921), mRNA 
0   14  NM_134516.2  CG32529-RA, transcript variant A (CG32529), mRNA 
0   14  NM_001038766.1  CG32529-RD, transcript variant D (CG32529), mRNA 
0   14  NM_167688.1  CG32529-RC, transcript variant C (CG32529), mRNA 
0   NM_206081.1  CG18377-RD, transcript variant D (Cyp49a1), mRNA 
0   NM_136744.2  CG18377-RA, transcript variant A (Cyp49a1), mRNA 
0   NM_143511.2  CG7946-RA (CG7946), mRNA 
0   NM_176143.1  CG2368-RH, transcript variant H (psq), mRNA 
0   NM_165791.1  CG2368-RD, transcript variant D (psq), mRNA 
0   NM_001014519.1  CG2368-RJ, transcript variant J (psq), mRNA 
0   NM_165792.1  CG2368-RE, transcript variant E (psq), mRNA 
0   NM_176142.1  CG2368-RG, transcript variant G (psq), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.