National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 30438R-2 
 Symbol CG30438  Full Name CG30438 
 CG No CG30438  Old CG No CG30438 
 Synonyms BcDNA:LD09936, BcDNA:RE54684, CG30438 
 Accession No (Link to NCBI) NM_165435.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GGAGCTTTCCCAGAGTGCTTCTTGGGATTAATGTACGACTTCAAGATTCCATTTATGTAC 60

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ATAAACACGGTGGGATTCTACACAGGCAGTATCTCGACTGCAGGAAATCCCGTTAGCTAC 120

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GCTATTACTCCCAACTTCTATTCTCGATTTACGGACACAATGAATCTTTACGAACGTGCT 180

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATTAATACGGCCATGCAGATTGGACAAACACTGATGCACATGTATGTTATGCGTCGGACT 240

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CACCTTGTGATGCGAGAGCACTTGGGTACTCAAATCCCGCATCCTTACGAAATGTCGCGC 300

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 AACGTGAGTTTCATTTTGCAAAATGGACACGCAGTTTTGTCTTATCCTAGAGCCTTTAAT 360

                           || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 CCGAATGTAGCAGAAGTGGCTTGCATTCATTGTAGGCCAGCTAGAAAACTTCCTAGAAAC 420

                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 CTTGAGGAATTCATCGGTGCTTCTGGAGCATCTGGATTTATTTACGTTTCTATGGGTTCC 480

30438R-2.IR_full       481 TCCGTANNGGCNGCGAACAT 500
                           ||||||  ||| |||||||| silico     481 TCCGTAAAGGCCGCGAACAT 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165436.1  CG30438-RB, transcript variant B (CG30438), mRNA 
100   482  NM_165435.1  CG30438-RA, transcript variant A (CG30438), mRNA 
100   482  NM_165437.1  CG30438-RC, transcript variant C (CG30438), mRNA 
100   482  NM_165438.1  CG30438-RD, transcript variant D (CG30438), mRNA 
0   NM_133040.1  CG7192-RA, transcript variant A (CG7192), mRNA 
0   NM_167602.1  CG7192-RB, transcript variant B (CG7192), mRNA 
0   NM_167480.1  CG9209-RC, transcript variant C (vap), mRNA 
0   NM_206759.1  CG9209-RD, transcript variant D (vap), mRNA 
0   NM_078637.2  CG9209-RB, transcript variant B (vap), mRNA 
0   NM_167481.2  CG9209-RA, transcript variant A (vap), mRNA 
0   NM_168670.1  CG32158-RB, transcript variant B (CG32158), mRNA 
0   NM_168671.2  CG32158-RA, transcript variant A (CG32158), mRNA 
0   NM_206386.1  CG32158-RF, transcript variant F (CG32158), mRNA 
0   NM_139907.2  CG8254-RA (exex), mRNA 
0   NM_079282.1  CG3322-RA (LanB2), mRNA 
0   NM_143791.2  CG6421-RA (CG6421), mRNA 
0   NM_001038739.1  CG9900-RC, transcript variant C (mit(1)15), mRNA 
0   NM_080162.3  CG9900-RB, transcript variant B (mit(1)15), mRNA 
0   NM_058013.3  CG7393-RA (p38b), mRNA 
0   NM_166132.2  CG8389-RA, transcript variant A (CG8389), mRNA 
0   NM_001042893.1  CG5461-RE, transcript variant E (bun), mRNA 
0   NM_141503.2  CG2702-RA (CG2702), mRNA 
0   NM_169295.2  CG9423-RA, transcript variant A (Kap-alpha3), mRNA 
0   NM_167322.3  CG32652-RA (CG32652), mRNA 
0   NM_132014.2  CG4119-RA (CG4119), mRNA 
0   NM_169296.2  CG9423-RB, transcript variant B (Kap-alpha3), mRNA 
0   NM_176437.1  CG9423-RC, transcript variant C (Kap-alpha3), mRNA 
0   12  NM_137221.1  CG8297-RA (CG8297), mRNA 
0   12  NM_206125.1  CG8295-RD, transcript variant D (Mlf), mRNA 
0   12  NM_166122.2  CG8295-RC, transcript variant C (Mlf), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.