National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 30438R-1 
 Symbol CG30438  Full Name CG30438 
 CG No CG30438  Old CG No CG30438 
 Synonyms BcDNA:LD09936, BcDNA:RE54684, CG30438 
 Accession No (Link to NCBI) NM_165435.1 
 Inserted Chr. lll 
 Insertional Mutation  lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGGAGCTTTCCCAGAGTGCTTC 
 Primer Seq. 3'
aatctagaggtaccATGTTCGCGGCCTTTACGGAG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GGAGCTTTCC CAGAGTGCTT CTTGGGATTA ATGTACGACT TCAAGATTCC ATTTATGTAC 
0061 ATAAACACGG TGGGATTCTA CACAGGCAGT ATCTCGACTG CAGGAAATCC CGTTAGCTAC 
0121 GCTATTACTC CCAACTTCTA TTCTCGATTT ACGGACACAA TGAATCTTTA CGAACGTGCT 
0181 ATTAATACGG CCATGCAGAT TGGACAAACA CTGATGCACA TGTATGTTAT GCGTCGGACT 
0241 CACCTTGTGA TGCGAGAGCA CTTGGGTACT CAAATCCCGC ATCCTTACGA AATGTCGCGC 
0301 AACGTGAGTT TCATTTTGCA AAATGGACAC GCAGTTTTGT CTTATCCTAG AGCCTTTAAT 
0361 CCAAATGTAG CAGAAGTGGC TTGCATTCAT TGTAGGCCAG CTAGAAAACT TCCTAGAAAC 
0421 CTTGAGGAAT TCATCGGTGC TTCTGGAGCA TCTGGATTTA TTTACGTTTC TATGGGTTCC 
0481 TCCGTANNGG cNGCGAACAT  
 in silico PCR Fragment
0001 GGAGCTTTCC CAGAGTGCTT CTTGGGATTA ATGTACGACT TCAAGATTCC ATTTATGTAC 
0061 ATAAACACGG TGGGATTCTA CACAGGCAGT ATCTCGACTG CAGGAAATCC CGTTAGCTAC 
0121 GCTATTACTC CCAACTTCTA TTCTCGATTT ACGGACACAA TGAATCTTTA CGAACGTGCT 
0181 ATTAATACGG CCATGCAGAT TGGACAAACA CTGATGCACA TGTATGTTAT GCGTCGGACT 
0241 CACCTTGTGA TGCGAGAGCA CTTGGGTACT CAAATCCCGC ATCCTTACGA AATGTCGCGC 
0301 AACGTGAGTT TCATTTTGCA AAATGGACAC GCAGTTTTGT CTTATCCTAG AGCCTTTAAT 
0361 CCGAATGTAG CAGAAGTGGC TTGCATTCAT TGTAGGCCAG CTAGAAAACT TCCTAGAAAC 
0421 CTTGAGGAAT TCATCGGTGC TTCTGGAGCA TCTGGATTTA TTTACGTTTC TATGGGTTCC 
0481 TCCGTAAAGG CCGCGAACAT  
 Assemble Data

30438R-1.IR_full       1   GGAGCTTTCCCAGAGTGCTTCTTGGGATTAATGTACGACTTCAAGATTCCATTTATGTAC 60
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30438R-1.in silico     1   GGAGCTTTCCCAGAGTGCTTCTTGGGATTAATGTACGACTTCAAGATTCCATTTATGTAC 60


30438R-1.IR_full       61  ATAAACACGGTGGGATTCTACACAGGCAGTATCTCGACTGCAGGAAATCCCGTTAGCTAC 120
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30438R-1.in silico     61  ATAAACACGGTGGGATTCTACACAGGCAGTATCTCGACTGCAGGAAATCCCGTTAGCTAC 120


30438R-1.IR_full       121 GCTATTACTCCCAACTTCTATTCTCGATTTACGGACACAATGAATCTTTACGAACGTGCT 180
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30438R-1.in silico     121 GCTATTACTCCCAACTTCTATTCTCGATTTACGGACACAATGAATCTTTACGAACGTGCT 180


30438R-1.IR_full       181 ATTAATACGGCCATGCAGATTGGACAAACACTGATGCACATGTATGTTATGCGTCGGACT 240
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30438R-1.in silico     181 ATTAATACGGCCATGCAGATTGGACAAACACTGATGCACATGTATGTTATGCGTCGGACT 240


30438R-1.IR_full       241 CACCTTGTGATGCGAGAGCACTTGGGTACTCAAATCCCGCATCCTTACGAAATGTCGCGC 300
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30438R-1.in silico     241 CACCTTGTGATGCGAGAGCACTTGGGTACTCAAATCCCGCATCCTTACGAAATGTCGCGC 300


30438R-1.IR_full       301 AACGTGAGTTTCATTTTGCAAAATGGACACGCAGTTTTGTCTTATCCTAGAGCCTTTAAT 360
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30438R-1.in silico     301 AACGTGAGTTTCATTTTGCAAAATGGACACGCAGTTTTGTCTTATCCTAGAGCCTTTAAT 360


30438R-1.IR_full       361 CCAAATGTAGCAGAAGTGGCTTGCATTCATTGTAGGCCAGCTAGAAAACTTCCTAGAAAC 420
                           || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30438R-1.in silico     361 CCGAATGTAGCAGAAGTGGCTTGCATTCATTGTAGGCCAGCTAGAAAACTTCCTAGAAAC 420


30438R-1.IR_full       421 CTTGAGGAATTCATCGGTGCTTCTGGAGCATCTGGATTTATTTACGTTTCTATGGGTTCC 480
                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
30438R-1.in silico     421 CTTGAGGAATTCATCGGTGCTTCTGGAGCATCTGGATTTATTTACGTTTCTATGGGTTCC 480


30438R-1.IR_full       481 TCCGTANNGGCNGCGAACAT 500
                           ||||||  ||| ||||||||
30438R-1.in silico     481 TCCGTAAAGGCCGCGAACAT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165436.1  CG30438-RB, transcript variant B (CG30438), mRNA 
100   482  NM_165435.1  CG30438-RA, transcript variant A (CG30438), mRNA 
100   482  NM_165437.1  CG30438-RC, transcript variant C (CG30438), mRNA 
100   482  NM_165438.1  CG30438-RD, transcript variant D (CG30438), mRNA 
0   NM_133040.1  CG7192-RA, transcript variant A (CG7192), mRNA 
0   NM_167602.1  CG7192-RB, transcript variant B (CG7192), mRNA 
0   NM_167480.1  CG9209-RC, transcript variant C (vap), mRNA 
0   NM_206759.1  CG9209-RD, transcript variant D (vap), mRNA 
0   NM_078637.2  CG9209-RB, transcript variant B (vap), mRNA 
0   NM_167481.2  CG9209-RA, transcript variant A (vap), mRNA 
0   NM_168670.1  CG32158-RB, transcript variant B (CG32158), mRNA 
0   NM_168671.2  CG32158-RA, transcript variant A (CG32158), mRNA 
0   NM_206386.1  CG32158-RF, transcript variant F (CG32158), mRNA 
0   NM_139907.2  CG8254-RA (exex), mRNA 
0   NM_079282.1  CG3322-RA (LanB2), mRNA 
0   NM_143791.2  CG6421-RA (CG6421), mRNA 
0   NM_001038739.1  CG9900-RC, transcript variant C (mit(1)15), mRNA 
0   NM_080162.3  CG9900-RB, transcript variant B (mit(1)15), mRNA 
0   NM_058013.3  CG7393-RA (p38b), mRNA 
0   NM_166132.2  CG8389-RA, transcript variant A (CG8389), mRNA 
0   NM_001042893.1  CG5461-RE, transcript variant E (bun), mRNA 
0   NM_141503.2  CG2702-RA (CG2702), mRNA 
0   NM_169295.2  CG9423-RA, transcript variant A (Kap-alpha3), mRNA 
0   NM_167322.3  CG32652-RA (CG32652), mRNA 
0   NM_132014.2  CG4119-RA (CG4119), mRNA 
0   NM_169296.2  CG9423-RB, transcript variant B (Kap-alpha3), mRNA 
0   NM_176437.1  CG9423-RC, transcript variant C (Kap-alpha3), mRNA 
0   12  NM_137221.1  CG8297-RA (CG8297), mRNA 
0   12  NM_206125.1  CG8295-RD, transcript variant D (Mlf), mRNA 
0   12  NM_166122.2  CG8295-RC, transcript variant C (Mlf), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.