National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3038R-4 
 Symbol CG3038  Full Name CG3038 
 CG No CG3038  Old CG No CG3038 
 Synonyms EG:BACR37P7.1, CG3038 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCGCATGCGCGGACGAAGA 
 Primer Seq. 3'
aatctagaggtaccCACTTTAATCCCATTACGTGT 
 Predicted Fragment Size
512 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

3038R-4.IR full       1   ATGCGCATGCGCGGACGAAGATTGCTTCCGATTATTTTGTCGCTTCTTTTGATCGTCCTA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3038R-4.in silico     1   ATGCGCATGCGCGGACGAAGATTGCTTCCGATTATTTTGTCGCTTCTTTTGATCGTCCTA 60


3038R-4.IR full       61  CTGAGTCTCTGTTACTTTTCGAATCACTTGAGGGATTCAAGCCAGTCCCGCAAAAACGGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3038R-4.in silico     61  CTGAGTCTCTGTTACTTTTCGAATCACTTGAGGGATTCAAGCCAGTCCCGCAAAAACGGT 120


3038R-4.IR full       121 TTCTTGCTGCACTTACCACTCGAAACGAAGAGGAATCCATCTAACCCTAATACTCCGTTA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3038R-4.in silico     121 TTCTTGCTGCACTTACCACTCGAAACGAAGAGGAATCCATCTAACCCTAATACTCCGTTA 180


3038R-4.IR full       181 AGTAATCTTCTGAATCTCACGGACTTCCACTACTTGCTGGCCAGTAATGTGTGTCGAAAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3038R-4.in silico     181 AGTAATCTTCTGAATCTCACGGACTTCCACTACTTGCTGGCCAGTAATGTGTGTCGAAAG 240


3038R-4.IR full       241 GCAAAAAGAGAACTCTTAGCCGTTTTAATAGTTACTTCGTATGCCGGACACGATGCCTTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3038R-4.in silico     241 GCAAAAAGAGAACTCTTAGCCGTTTTAATAGTTACTTCGTATGCCGGACACGATGCCTTG 300


3038R-4.IR full       301 CGATCAGCTCACCGACAGGCAATTCCCCAAAGCAAACTGGAAGAAATGGGCCTGCGAAGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3038R-4.in silico     301 CGATCAGCTCACCGACAGGCAATTCCCCAAAGCAAACTGGAAGAAATGGGCCTGCGAAGA 360


3038R-4.IR full       361 GTTTTTCTCTTGGCAGCCCTGCCTTCAAGAGAGCATTTTATAAGCCAGGATCAACTGGCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3038R-4.in silico     361 GTTTTTCTCTTGGCAGCCCTGCCTTCAAGAGAGCATTTTATAAGCCAGGATCAACTGGCC 420


3038R-4.IR full       421 AGCGAACAGAATCGTTTCGGGGACCTTCTCCAGGGGAATTTCATCGAGGACTATCGCAAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3038R-4.in silico     421 AGCGAACAGAATCGTTTCGGGGACCTTCTCCAGGGGAATTTCATCGAGGACTATCGCAAT 480


3038R-4.IR full       481 CTGAGCTACAAACACGTAATGGGATTAAAGTG 512
                          ||||||||||||||||||||||||||||||||
3038R-4.in silico     481 CTGAGCTACAAACACGTAATGGGATTAAAGTG 512

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  494  NM_130477.2  CG3038-RA, transcript variant A (CG3038), mRNA 
81.37  402  NM_166834.1  CG3038-RB, transcript variant B (CG3038), mRNA 
NM_140200.1  CG6175-RB (CG6175), mRNA 
NM_137616.2  CG11208-RA (CG11208), mRNA 
NM_136574.2  CG8258-RA (CG8258), mRNA 
NM_132531.1  CG11802-RA (CG11802), mRNA 
NM_001038822.1  yuri gagarin CG31732-RG, transcript variant G (yuri), mRNA 
NM_001038820.1  yuri gagarin CG31732-RE, transcript variant E (yuri), mRNA 
NM_001038821.1  yuri gagarin CG31732-RF, transcript variant F (yuri), mRNA 
NM_165106.4  yuri gagarin CG31732-RB, transcript variant B (yuri), mRNA 
NM_165166.1  CG31816-RA (CG31816), mRNA 
NM_165167.1  CG31815-RA (CG31815), mRNA 
NM_167226.1  CG32686-RB, transcript variant B (CG32686), mRNA 
NM_167227.1  CG32686-RA, transcript variant A (CG32686), mRNA 
NM_137156.2  Cyp6a23 CG10242-RA (Cyp6a23), mRNA 
12  NM_144448.2  sallimus CG1915-RC, transcript variant C (sls), mRNA 
11  NM_134820.2  CG10882-RA (CG10882), mRNA 
NM_143496.3  CG15523-RA (CG15523), mRNA 
NM_080103.2  onecut CG1922-RA (onecut), mRNA 
NM_135021.2  CG12194-RA (CG12194), mRNA 
NM_136455.1  CG2093-RA (CG2093), mRNA 
NM_001043006.1  Nipped-A CG33554-RB, transcript variant B (Nipped-A), mRNA 
NM_001043007.1  Nipped-A CG33554-RC, transcript variant C (Nipped-A), mRNA 
NM_001014499.2  Nipped-A CG33554-RA, transcript variant A (Nipped-A), mRNA 
NM_132083.3  CG3815-RA (CG3815), mRNA 
NM_169785.1  heartless CG7223-RC, transcript variant C (htl), mRNA 
NM_169784.1  heartless CG7223-RA, transcript variant A (htl), mRNA 
NM_165350.2  CG9339-RB, transcript variant B (CG9339), mRNA 
NM_079234.2  quemao CG8593-RA (qm), mRNA 
NM_165348.2  CG9339-RE, transcript variant E (CG9339), mRNA 
100  494  NM_166834.1  CG3038-RB, transcript variant B (CG3038), mRNA 
NM_137162.1  CG10253-RA (CG10253), mRNA 
NM_168605.1  Glycyl-tRNA synthetase CG6778-RB, transcript variant B (Aats-gly), mRNA 
NM_140489.2  Glycyl-tRNA synthetase CG6778-RA, transcript variant A (Aats-gly), mRNA 
NM_137721.1  CG18375-RA, transcript variant A (CG18375), mRNA 
NM_176243.1  CG18375-RB, transcript variant B (CG18375), mRNA 
NM_139580.2  imaginal discs arrested CG10850-RA, transcript variant A (ida), mRNA 
NM_206273.1  imaginal discs arrested CG10850-RB, transcript variant B (ida), mRNA 
NM_176445.1  MICAL CG33208-RC, transcript variant C (MICAL), mRNA 
NM_176449.1  MICAL CG33208-RH, transcript variant H (MICAL), mRNA 
NM_176447.1  MICAL CG33208-RF, transcript variant F (MICAL), mRNA 
NM_176444.1  MICAL CG33208-RB, transcript variant B (MICAL), mRNA 
NM_176443.1  MICAL CG33208-RE, transcript variant E (MICAL), mRNA 
NM_176448.1  MICAL CG33208-RG, transcript variant G (MICAL), mRNA 
NM_176446.1  MICAL CG33208-RD, transcript variant D (MICAL), mRNA 
NM_135846.2  CG16884-RA (CG16884), mRNA 
NM_165932.1  CG8785-RB, transcript variant B (CG8785), mRNA 
NM_136960.2  CG8785-RA, transcript variant A (CG8785), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.