National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
Notification of resumption of orders:

Orders have been suspended as a response to the COVID-19 infection, but it will be resumed today, May 11. However, we would like to set our organizational framework that prioritizes the maintenance of stocks for the time being. In addition, due to delays in delivery of postal items, it is expected that the flies you ordered will not reach you in normal period. We apologize for the inconvenience.

Thank you for your understanding.

NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 3038R-1 
 Symbol CG3038  Full Name CG3038 
 CG No CG3038  Old CG No CG3038 
 Synonyms EG:BACR37P7.1, CG3038 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATGCGCATGCGCGGACGAAGA 
 Primer Seq. 3'
aatctagaggtaccCACTTTAATCCCATTACGTGT 
 Predicted Fragment Size
512 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

3038R-1.IR full       1   ATGCGCATGCGCGGACGAAGATTGCTTCCGATTATTTTGTCGCTTCTTTTGATCGTCCTA 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3038R-1.in silico     1   ATGCGCATGCGCGGACGAAGATTGCTTCCGATTATTTTGTCGCTTCTTTTGATCGTCCTA 60


3038R-1.IR full       61  CTGAGTCTCTGTTACTTTTCGAATCACTTGAGGGATTCAAGCCAGTCCCGCAAAAACGGT 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3038R-1.in silico     61  CTGAGTCTCTGTTACTTTTCGAATCACTTGAGGGATTCAAGCCAGTCCCGCAAAAACGGT 120


3038R-1.IR full       121 TTCTTGCTGCACTTACCACTCGAAACGAAGAGGAATCCATCTAACCCTAATACTCCGTTA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3038R-1.in silico     121 TTCTTGCTGCACTTACCACTCGAAACGAAGAGGAATCCATCTAACCCTAATACTCCGTTA 180


3038R-1.IR full       181 AGTAATCTTCTGAATCTCACGGACTTCCACTACTTGCTGGCCAGTAATGTGTGTCGAAAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3038R-1.in silico     181 AGTAATCTTCTGAATCTCACGGACTTCCACTACTTGCTGGCCAGTAATGTGTGTCGAAAG 240


3038R-1.IR full       241 GCAAAAAGAGAACTCTTAGCCGTTTTAATAGTTACTTCGTATGCCGGACACGATGCCTTG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3038R-1.in silico     241 GCAAAAAGAGAACTCTTAGCCGTTTTAATAGTTACTTCGTATGCCGGACACGATGCCTTG 300


3038R-1.IR full       301 CGATCAGCTCACCGACAGGCAATTCCCCAAAGCAAACTGGAAGAAATGGGCCTGCGAAGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3038R-1.in silico     301 CGATCAGCTCACCGACAGGCAATTCCCCAAAGCAAACTGGAAGAAATGGGCCTGCGAAGA 360


3038R-1.IR full       361 GTTTTTCTCTTGGCAGCCCTGCCTTCAAGAGAGCATTTTATAAGCCAGGATCAACTGGCC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3038R-1.in silico     361 GTTTTTCTCTTGGCAGCCCTGCCTTCAAGAGAGCATTTTATAAGCCAGGATCAACTGGCC 420


3038R-1.IR full       421 AGCGAACAGAATCGTTTCGGGGACCTTCTCCAGGGGAATTTCATCGAGGACTATCGCAAT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
3038R-1.in silico     421 AGCGAACAGAATCGTTTCGGGGACCTTCTCCAGGGGAATTTCATCGAGGACTATCGCAAT 480


3038R-1.IR full       481 CTGAGCTACAAACACGTAATGGGATTAAAGTG 512
                          ||||||||||||||||||||||||||||||||
3038R-1.in silico     481 CTGAGCTACAAACACGTAATGGGATTAAAGTG 512

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  494  NM_130477.2  CG3038-RA, transcript variant A (CG3038), mRNA 
81.37  402  NM_166834.1  CG3038-RB, transcript variant B (CG3038), mRNA 
NM_140200.1  CG6175-RB (CG6175), mRNA 
NM_137616.2  CG11208-RA (CG11208), mRNA 
NM_136574.2  CG8258-RA (CG8258), mRNA 
NM_132531.1  CG11802-RA (CG11802), mRNA 
NM_001038822.1  yuri gagarin CG31732-RG, transcript variant G (yuri), mRNA 
NM_001038820.1  yuri gagarin CG31732-RE, transcript variant E (yuri), mRNA 
NM_001038821.1  yuri gagarin CG31732-RF, transcript variant F (yuri), mRNA 
NM_165106.4  yuri gagarin CG31732-RB, transcript variant B (yuri), mRNA 
NM_165166.1  CG31816-RA (CG31816), mRNA 
NM_165167.1  CG31815-RA (CG31815), mRNA 
NM_167226.1  CG32686-RB, transcript variant B (CG32686), mRNA 
NM_167227.1  CG32686-RA, transcript variant A (CG32686), mRNA 
NM_137156.2  Cyp6a23 CG10242-RA (Cyp6a23), mRNA 
12  NM_144448.2  sallimus CG1915-RC, transcript variant C (sls), mRNA 
11  NM_134820.2  CG10882-RA (CG10882), mRNA 
NM_143496.3  CG15523-RA (CG15523), mRNA 
NM_080103.2  onecut CG1922-RA (onecut), mRNA 
NM_135021.2  CG12194-RA (CG12194), mRNA 
NM_136455.1  CG2093-RA (CG2093), mRNA 
NM_001043006.1  Nipped-A CG33554-RB, transcript variant B (Nipped-A), mRNA 
NM_001043007.1  Nipped-A CG33554-RC, transcript variant C (Nipped-A), mRNA 
NM_001014499.2  Nipped-A CG33554-RA, transcript variant A (Nipped-A), mRNA 
NM_132083.3  CG3815-RA (CG3815), mRNA 
NM_169785.1  heartless CG7223-RC, transcript variant C (htl), mRNA 
NM_169784.1  heartless CG7223-RA, transcript variant A (htl), mRNA 
NM_165350.2  CG9339-RB, transcript variant B (CG9339), mRNA 
NM_079234.2  quemao CG8593-RA (qm), mRNA 
NM_165348.2  CG9339-RE, transcript variant E (CG9339), mRNA 
100  494  NM_166834.1  CG3038-RB, transcript variant B (CG3038), mRNA 
NM_137162.1  CG10253-RA (CG10253), mRNA 
NM_168605.1  Glycyl-tRNA synthetase CG6778-RB, transcript variant B (Aats-gly), mRNA 
NM_140489.2  Glycyl-tRNA synthetase CG6778-RA, transcript variant A (Aats-gly), mRNA 
NM_137721.1  CG18375-RA, transcript variant A (CG18375), mRNA 
NM_176243.1  CG18375-RB, transcript variant B (CG18375), mRNA 
NM_139580.2  imaginal discs arrested CG10850-RA, transcript variant A (ida), mRNA 
NM_206273.1  imaginal discs arrested CG10850-RB, transcript variant B (ida), mRNA 
NM_176445.1  MICAL CG33208-RC, transcript variant C (MICAL), mRNA 
NM_176449.1  MICAL CG33208-RH, transcript variant H (MICAL), mRNA 
NM_176447.1  MICAL CG33208-RF, transcript variant F (MICAL), mRNA 
NM_176444.1  MICAL CG33208-RB, transcript variant B (MICAL), mRNA 
NM_176443.1  MICAL CG33208-RE, transcript variant E (MICAL), mRNA 
NM_176448.1  MICAL CG33208-RG, transcript variant G (MICAL), mRNA 
NM_176446.1  MICAL CG33208-RD, transcript variant D (MICAL), mRNA 
NM_135846.2  CG16884-RA (CG16884), mRNA 
NM_165932.1  CG8785-RB, transcript variant B (CG8785), mRNA 
NM_136960.2  CG8785-RA, transcript variant A (CG8785), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.