National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2987R-2 
 Symbol alpha-catenin-related  Full Name alpha-catenin related 
 CG No CG2987  Old CG No CG2987 
 Synonyms alpha-catenin-related 
 Accession No (Link to NCBI) NM_143816.2 
 Inserted Chr. ll 
 Insertional Mutation  3 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   GCTTTCGAGTTCGTGATATGGATAACGAGCAGATCATGTCCACTTTTGGGAACATAGGTC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  ACCTGCTGAACATTGCCGTGGAGCGATTTATAACCATTGGCGAGATCATCGCCGAGGAGA 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 ATATTGACATCAAGGGAGACATGTACGAGGCGGCGAAGGAGGCCAGAGATGCGGGAAAAT 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 CGATTGAACGACTTTGTGATATTTCACCTCTAAGCGGCATGGAGCTGCGCCACCACATCG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 AGCCCCTTAAGGACTATGGAGCCATCATTTTGGCGGCCCGCTCCCTGCTGTCGTCCGTCA 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 CGCGCATCCTACTGCTGGTCGACATCATAGTTGTGAAGAAGCTGCTGACCGCCAAGAAGC 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 GGGCCTCCGAGAGCCTGGAGAAGCTGGAGTCGGTCATGAACTTCACGGAATTCGTGCGCG 420

                          |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| silico     421 CCTTCTCCGTGTTCGGAACCGAGATGATTGAGCTGGCCTACCTCACGGGCCACCACCGCA 480

2987R-2.IR_full       481 ACTCCTTCAAGGAGGAGCGA 500
                          |||||||||||||||||||| silico     481 ACTCCTTCAAGGAGGAGCGA 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143816.2  CG2987-RA, transcript variant A (alpha-catenin-related), mRNA 
100   482  NM_166641.1  CG2987-RB, transcript variant B (alpha-catenin-related), mRNA 
0   NM_132072.1  CG14446-RA (CG14446), mRNA 
0   NM_142872.1  CG13829-RA (CG13829), mRNA 
0   NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_135173.1  CG9501-RA (ppk14), mRNA 
0   NM_137039.1  CG13332-RA (CG13332), mRNA 
0   NM_140663.2  CG9705-RA, transcript variant A (CG9705), mRNA 
0   NM_168683.1  CG9705-RB, transcript variant B (CG9705), mRNA 
0   NM_137426.2  CG5033-RA, transcript variant A (CG5033), mRNA 
0   NM_166248.1  CG5033-RB, transcript variant B (CG5033), mRNA 
0   12  NM_169222.2  CG31462-RA (CG31462), mRNA 
0   NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
0   NM_169419.1  CG18476-RA (CG18476), mRNA 
0   NM_135541.1  CG13141-RA (CG13141), mRNA 
0   NM_141408.3  CG1137-RA (CG1137), mRNA 
0   NM_141438.2  CG10068-RA (CG10068), mRNA 
0   NM_143721.2  CG2128-RA (Hdac3), mRNA 
0   NM_168487.1  CG32096-RB, transcript variant B (rols), mRNA 
0   NM_140285.2  CG32096-RD, transcript variant D (rols), mRNA 
0   NM_168490.1  CG32096-RE, transcript variant E (rols), mRNA 
0   NM_168488.1  CG32096-RA, transcript variant A (rols), mRNA 
0   NM_168489.1  CG32096-RC, transcript variant C (rols), mRNA 
0   NM_169405.2  CG31363-RA, transcript variant A (Jupiter), mRNA 
0   NM_169404.2  CG31363-RD, transcript variant D (Jupiter), mRNA 
0   NM_165145.1  CG4824-RD, transcript variant D (BicC), mRNA 
0   NM_165144.1  CG4824-RB, transcript variant B (BicC), mRNA 
0   NM_169406.2  CG31363-RH, transcript variant H (Jupiter), mRNA 
0   NM_057517.2  CG4824-RA, transcript variant A (BicC), mRNA 
0   NM_080338.3  CG6824-RA, transcript variant A (ovo), mRNA 
 Wing Disc
JNK signal
Caspase-3 signal
Dcompartment   Penetrance

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.