National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2987R-2 
 Symbol alpha-catenin-related  Full Name alpha-catenin related 
 CG No CG2987  Old CG No CG2987 
 Synonyms alpha-catenin-related 
 Accession No (Link to NCBI) NM_143816.2 
 Inserted Chr. ll 
 Insertional Mutation  3 lethal 
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Umetsu D, Dunst S, Dahmann C.
An RNA interference screen for genes required to shape the anteroposterior compartment boundary in Drosophila identifies the Eph receptor.
PLoS ONE (2014) 9(12) e114340 [ PubMed ID = 25473846 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGCTTTCGAGTTCGTGATATGG 
 Primer Seq. 3'
aatctagaggtaccTCGCTCCTCCTTGAAGGAGTT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 GCTTTCGAGT TCGTGATATG GATAACGAGC AGATCATGTC CACTTTTGGG AACATAGGTC 
0061 ACCTGCTGAA CATTGCCGTG GAGCGATTTA TAACCATTGG CGAGATCATC GCCGAGGAGA 
0121 ATATTGACAT CAAGGGAGAC ATGTACGAGG CGGCGAAGGA GGCCAGAGAT GCGGGAAAAT 
0181 CGATTGAACG ACTTTGTGAT ATTTCACCTC TAAGCGGCAT GGAGCTGCGC CACCACATCG 
0241 AGCCCCTTAA GGACTATGGA GCCATCATTT TGGCGGCCCG CTCCCTGCTG TCGTCCGTCA 
0301 CGCGCATCCT ACTGCTGGTC GACATCATAG TTGTGAAGAA GCTGCTGACC GCCAAGAAGC 
0361 GGGCCTCCGA GAGCCTGGAG AAGCTGGAGT CGGTCATGAA CTTCACGGAA TTCGTGCGCG 
0421 CCTTCTCCGT GTTCGGAACC GAGATGATTG AGCTGGCCTA NCTCACGGGC CACCACCGCA 
0481 ACTCCTTCAA GGAGGAGCGA  
 in silico PCR Fragment
0001 GCTTTCGAGT TCGTGATATG GATAACGAGC AGATCATGTC CACTTTTGGG AACATAGGTC 
0061 ACCTGCTGAA CATTGCCGTG GAGCGATTTA TAACCATTGG CGAGATCATC GCCGAGGAGA 
0121 ATATTGACAT CAAGGGAGAC ATGTACGAGG CGGCGAAGGA GGCCAGAGAT GCGGGAAAAT 
0181 CGATTGAACG ACTTTGTGAT ATTTCACCTC TAAGCGGCAT GGAGCTGCGC CACCACATCG 
0241 AGCCCCTTAA GGACTATGGA GCCATCATTT TGGCGGCCCG CTCCCTGCTG TCGTCCGTCA 
0301 CGCGCATCCT ACTGCTGGTC GACATCATAG TTGTGAAGAA GCTGCTGACC GCCAAGAAGC 
0361 GGGCCTCCGA GAGCCTGGAG AAGCTGGAGT CGGTCATGAA CTTCACGGAA TTCGTGCGCG 
0421 CCTTCTCCGT GTTCGGAACC GAGATGATTG AGCTGGCCTA CCTCACGGGC CACCACCGCA 
0481 ACTCCTTCAA GGAGGAGCGA  
 Assemble Data

2987R-2.IR_full       1   GCTTTCGAGTTCGTGATATGGATAACGAGCAGATCATGTCCACTTTTGGGAACATAGGTC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2987R-2.in silico     1   GCTTTCGAGTTCGTGATATGGATAACGAGCAGATCATGTCCACTTTTGGGAACATAGGTC 60


2987R-2.IR_full       61  ACCTGCTGAACATTGCCGTGGAGCGATTTATAACCATTGGCGAGATCATCGCCGAGGAGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2987R-2.in silico     61  ACCTGCTGAACATTGCCGTGGAGCGATTTATAACCATTGGCGAGATCATCGCCGAGGAGA 120


2987R-2.IR_full       121 ATATTGACATCAAGGGAGACATGTACGAGGCGGCGAAGGAGGCCAGAGATGCGGGAAAAT 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2987R-2.in silico     121 ATATTGACATCAAGGGAGACATGTACGAGGCGGCGAAGGAGGCCAGAGATGCGGGAAAAT 180


2987R-2.IR_full       181 CGATTGAACGACTTTGTGATATTTCACCTCTAAGCGGCATGGAGCTGCGCCACCACATCG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2987R-2.in silico     181 CGATTGAACGACTTTGTGATATTTCACCTCTAAGCGGCATGGAGCTGCGCCACCACATCG 240


2987R-2.IR_full       241 AGCCCCTTAAGGACTATGGAGCCATCATTTTGGCGGCCCGCTCCCTGCTGTCGTCCGTCA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2987R-2.in silico     241 AGCCCCTTAAGGACTATGGAGCCATCATTTTGGCGGCCCGCTCCCTGCTGTCGTCCGTCA 300


2987R-2.IR_full       301 CGCGCATCCTACTGCTGGTCGACATCATAGTTGTGAAGAAGCTGCTGACCGCCAAGAAGC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2987R-2.in silico     301 CGCGCATCCTACTGCTGGTCGACATCATAGTTGTGAAGAAGCTGCTGACCGCCAAGAAGC 360


2987R-2.IR_full       361 GGGCCTCCGAGAGCCTGGAGAAGCTGGAGTCGGTCATGAACTTCACGGAATTCGTGCGCG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2987R-2.in silico     361 GGGCCTCCGAGAGCCTGGAGAAGCTGGAGTCGGTCATGAACTTCACGGAATTCGTGCGCG 420


2987R-2.IR_full       421 CCTTCTCCGTGTTCGGAACCGAGATGATTGAGCTGGCCTANCTCACGGGCCACCACCGCA 480
                          |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
2987R-2.in silico     421 CCTTCTCCGTGTTCGGAACCGAGATGATTGAGCTGGCCTACCTCACGGGCCACCACCGCA 480


2987R-2.IR_full       481 ACTCCTTCAAGGAGGAGCGA 500
                          ||||||||||||||||||||
2987R-2.in silico     481 ACTCCTTCAAGGAGGAGCGA 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_143816.2  CG2987-RA, transcript variant A (alpha-catenin-related), mRNA 
100   482  NM_166641.1  CG2987-RB, transcript variant B (alpha-catenin-related), mRNA 
0   NM_132072.1  CG14446-RA (CG14446), mRNA 
0   NM_142872.1  CG13829-RA (CG13829), mRNA 
0   NM_058149.3  CG3352-RA (ft), mRNA 
0   NM_135173.1  CG9501-RA (ppk14), mRNA 
0   NM_137039.1  CG13332-RA (CG13332), mRNA 
0   NM_140663.2  CG9705-RA, transcript variant A (CG9705), mRNA 
0   NM_168683.1  CG9705-RB, transcript variant B (CG9705), mRNA 
0   NM_137426.2  CG5033-RA, transcript variant A (CG5033), mRNA 
0   NM_166248.1  CG5033-RB, transcript variant B (CG5033), mRNA 
0   12  NM_169222.2  CG31462-RA (CG31462), mRNA 
0   NM_137690.2  CG10543-RA, transcript variant A (CG10543), mRNA 
0   NM_169419.1  CG18476-RA (CG18476), mRNA 
0   NM_135541.1  CG13141-RA (CG13141), mRNA 
0   NM_141408.3  CG1137-RA (CG1137), mRNA 
0   NM_141438.2  CG10068-RA (CG10068), mRNA 
0   NM_143721.2  CG2128-RA (Hdac3), mRNA 
0   NM_168487.1  CG32096-RB, transcript variant B (rols), mRNA 
0   NM_140285.2  CG32096-RD, transcript variant D (rols), mRNA 
0   NM_168490.1  CG32096-RE, transcript variant E (rols), mRNA 
0   NM_168488.1  CG32096-RA, transcript variant A (rols), mRNA 
0   NM_168489.1  CG32096-RC, transcript variant C (rols), mRNA 
0   NM_169405.2  CG31363-RA, transcript variant A (Jupiter), mRNA 
0   NM_169404.2  CG31363-RD, transcript variant D (Jupiter), mRNA 
0   NM_165145.1  CG4824-RD, transcript variant D (BicC), mRNA 
0   NM_165144.1  CG4824-RB, transcript variant B (BicC), mRNA 
0   NM_169406.2  CG31363-RH, transcript variant H (Jupiter), mRNA 
0   NM_057517.2  CG4824-RA, transcript variant A (BicC), mRNA 
0   NM_080338.3  CG6824-RA, transcript variant A (ovo), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
++ 
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
 
DB
DC
DM
 
VM
 
VB
 
Dcompartment   Penetrance
     

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.