National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2983R-3 
 Symbol CG2983  Full Name CG2983 
 CG No CG2983  Old CG No CG2983 
 Synonyms CG2983 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgATCGGAGCAATCATTCCCAGC 
 Primer Seq. 3'
aatctagaggtaccCTGTGGACTGTAGGGATAGAC 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

2983R-3.IR full       1   GATCGGAGCAATCATTCCCAGCCGAATACAACGTCGCCATCAACAGCTCGTCCAGTACTT 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2983R-3.in silico     1   -ATCGGAGCAATCATTCCCAGCCGAATACAACGTCGCCATCAACAGCTCGTCCAGTACTT 60


2983R-3.IR full       61  TTCCTGCTCCTGGGCATCGGAATTGGCTATCTGATCACCCAGGTTCTTGTATGGCCAATT 120
                          ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||
2983R-3.in silico     61  TTCCTGCTCCTGGGCATCGGAATTGGCTATCTGATCACCAAGGTTCTTGTATGGCCAATT 120


2983R-3.IR full       121 ATGGATCTCAAATCGCACACAAATCGCACGGGTGCATCGACTTCACTGGACATCGATTTG 180
                          |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||
2983R-3.in silico     121 ATGGATCTCAAATCGCACACGAATCGCACGGGTGCATCGACTTCACTGGACATCGATTTG 180


2983R-3.IR full       181 ACCGAGGAGGTGCGAGTCCTGTGCTATGTGTACACCAAACCCATTAATCACAAGACTCAG 240
                          ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||
2983R-3.in silico     181 ACCGATGAGGTGCGAGTCCTGTGCTATGTGTACACCAAACCCATTAATCACAAGACTCAG 240


2983R-3.IR full       241 GCCCAAGCCGTTTTGGAAACTTGGGGCAGGCGATGCAACAAGTTGATCTTCTTTAGCAGC 300
                          |||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||||
2983R-3.in silico     241 GCCCAAGCCGTTTTGGAAACTTGGGGCAGGCGGTGCAACAAGCTGATCTTCTTTAGCAGC 300


2983R-3.IR full       301 CGCTCTGATCTCAATCTAACTGGATCTGTGGAACTGCCCGTAAGCCCCTACTTCCGGGAG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2983R-3.in silico     301 CGCTCTGATCTCAATCTAACTGGATCTGTGGAACTGCCCGTAAGCCCCTACTTCCGGGAG 360


2983R-3.IR full       361 TCGTGGCTAAAAACGAAGATGGCCTTGAAGTACCTTTATGATCATCATCTAAACGATGCC 420
                          |||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||
2983R-3.in silico     361 TCGTGGCTAAAAACGAAGATGGCCTTGAAGTACCTTCATGATCATCACCTAAACGATGCC 420


2983R-3.IR full       421 GATTGGTTCCTGGAGGCTGACGACGAGACATACGTGGTGATGGAGAACCTGCGATACATG 480
                          ||||||||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||
2983R-3.in silico     421 GATTGGTTCCTAGAGGCTGACGACGAGACGTACGTGGTGATGGAGAACCTGAGATACATG 480


2983R-3.IR full       481 GTCTATCCCTACAGTCCACAG 501
                          |||||||||||||||||||||
2983R-3.in silico     481 GTCTATCCCTACAGTCCACAG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_134879.1  CG2983-RA (CG2983), mRNA 
0.41  NM_079582.2  mitochondrial ribosomal protein L37 CG6547-RA (mRpL37), mRNA 
14  11  NM_001038890.1  CG34056-RA (CG34056), mRNA 
11  NM_134875.1  CG2975-RA (CG2975), mRNA 
17  35  NM_135414.2  CG9520-RB, transcript variant B (CG9520), mRNA 
17  35  NM_164840.1  CG9520-RC, transcript variant C (CG9520), mRNA 
17  35  NM_164839.1  CG9520-RA, transcript variant A (CG9520), mRNA 
12  11  NM_134873.1  CG3119-RA, transcript variant A (CG3119), mRNA 
12  11  NM_164504.1  CG3119-RB, transcript variant B (CG3119), mRNA 
NM_206610.1  CG14047-RB, transcript variant B (CG14047), mRNA 
NM_130645.2  CG14047-RA, transcript variant A (CG14047), mRNA 
NM_079557.3  Odorant receptor 85d CG11742-RA (Or85d), mRNA 
NM_078597.2  mitochondrial ribosomal protein L38 CG15871-RA (mRpL38), mRNA 
NM_137759.3  CG30263-RA (CG30263), mRNA 
32  NM_001038765.1  twiggy CG7440-RB, transcript variant B (tgy), mRNA 
NM_137255.2  CG15706-RA (CG15706), mRNA 
27  NM_133121.3  twiggy CG7440-RA, transcript variant A (tgy), mRNA 
NM_136672.2  CG1688-RA (CG1688), mRNA 
NM_078589.2  strawberry notch CG1903-RB, transcript variant B (sno), mRNA 
NM_001031859.1  Calcium activated protein for secretion CG33653-RB, transcript variant B (Caps), mRNA 
NM_001031858.1  Calcium activated protein for secretion CG33653-RC, transcript variant C (Caps), mRNA 
NM_135004.1  CG3355-RA, transcript variant A (CG3355), mRNA 
NM_164594.1  CG3355-RB, transcript variant B (CG3355), mRNA 
NM_135750.1  CG16800-RA (CG16800), mRNA 
NM_001031860.1  Calcium activated protein for secretion CG33653-RA, transcript variant A (Caps), mRNA 
NM_001015081.1  CG40477-PA.3 (CG40477), partial mRNA 
NM_134684.2  Mediator complex subunit 15 CG4184-RA (MED15), mRNA 
NM_142638.2  CG5412-RA (CG5412), mRNA 
NM_167028.1  rugose CG6775-RB, transcript variant B (rg), mRNA 
NM_080023.1  rugose CG6775-RA, transcript variant A (rg), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.