National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2922R-2 
 Symbol exba  Full Name extra bases 
 CG No CG2922  Old CG No CG2922 
 Synonyms eIF-5C, CT7240, elF-5C, CG2922, Decp, l(3)03022, anon-WO0172774.49, exba 
 Accession No (Link to NCBI) NM_169074.1 
 Inserted Chr.
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Jia D, Soylemez M, Calvin G, Bornmann R, Bryant J, Hanna C, Huang YC, Deng WM.
A large-scale in vivo RNAi screen to identify genes involved in Notch-mediated follicle cell differentiation and cell cycle switches.
Sci Rep (2015) 5 12328 [ PubMed ID = 26205122 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCGACTATCGTCGCTACGGTGA 
 Primer Seq. 3'
aatctagaggtaccCAGTACGTTTGTTCGGTGGGA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 CGACTATCGT CGcTACGGTG AAGTTCTCTT TGACATATTG ATTGCAGGAG GTCTACTAGT 
0061 GCCTGGTGGT TCTATATCTC AGGATGGCGA AAAGcCGCGC ACAAGCTACT GCATCTTCGA 
0121 TGCGCCCGAG AGCATGGAGA GCATGCGCAA CCATGAGCAG GTATTTGTCA AGCTCATCAG 
0181 ACGGTACAAG TACCTTGAGA AAATGTTCGA AGAGGAGATG GGAAAGGTTC TATTATTCGT 
0241 AAAGGGCTTT ACTCCTAGTG AACGCATNCA AGCTTGCGCG TATGACAGCG CTCTGGTTAG 
0301 TCAACGGTTC TGTACCGCCA AATGTTTTAC TGGTACTAAA CAACGAGCAC CTAATCAAGG 
0361 ATGGCATTGC ATTGGAGTTT CTACTAGAGC TGTTCCAGAC GTTCAAGCAA GAGAAGGGCA 
0421 TTGCATATCT GATTCAGGCG CTTAAGAAGG GTGGACTGGA AAGCAAACTT ATGGACTTTT 
0481 TCCCACCGAA CAAACGTACT G 
 in silico PCR Fragment
0001 CGACTATCGT CGCTACGGTG AAGTTCTCTT TGACATATTG ATTGCAGGAG GTCTACTAGT 
0061 GCCTGGTGGT TCTATATCTC AGGATGGCGA AAAGCCGCGC ACAAGCTACT GCATCTTCGA 
0121 TGCGCCCGAG AGCATGGAGA GCATGCGCAA CCATGAGCAG GTATTTGTCA AGCTCATCAG 
0181 ACGGTACAAG TACCTTGAGA AAATGTTCGA AGAGGAGATG GGAAAGGTTC TATTATTCGT 
0241 AAAGGGCTTT ACTCCTAGTG AACGCAT-CA AGCTTGCGCG TATGACAGCG CTCTGGTTAG 
0301 TCAACGGTTC TGTACCGCCA AATGTTTTAC TGGTACTAAA CAACGAGCAC CTAATCAAGG 
0361 ATGGCATTGC ATTGGAGTTT CTACTAGAGC TGTTCCAGAC GTTCAAGCAA GAGAAGGGCA 
0421 TTGCATATCT GATTCAGGCG CTTAAGAAGG GTGGACTGGA AAGCAAACTT ATGGACTTTT 
0481 TCCCACCGAA CAAACGTACT G 
 Assemble Data

2922R-2.IR_full       1   CGACTATCGTCGCTACGGTGAAGTTCTCTTTGACATATTGATTGCAGGAGGTCTACTAGT 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2922R-2.in silico     1   CGACTATCGTCGCTACGGTGAAGTTCTCTTTGACATATTGATTGCAGGAGGTCTACTAGT 60


2922R-2.IR_full       61  GCCTGGTGGTTCTATATCTCAGGATGGCGAAAAGCCGCGCACAAGCTACTGCATCTTCGA 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2922R-2.in silico     61  GCCTGGTGGTTCTATATCTCAGGATGGCGAAAAGCCGCGCACAAGCTACTGCATCTTCGA 120


2922R-2.IR_full       121 TGCGCCCGAGAGCATGGAGAGCATGCGCAACCATGAGCAGGTATTTGTCAAGCTCATCAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2922R-2.in silico     121 TGCGCCCGAGAGCATGGAGAGCATGCGCAACCATGAGCAGGTATTTGTCAAGCTCATCAG 180


2922R-2.IR_full       181 ACGGTACAAGTACCTTGAGAAAATGTTCGAAGAGGAGATGGGAAAGGTTCTATTATTCGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2922R-2.in silico     181 ACGGTACAAGTACCTTGAGAAAATGTTCGAAGAGGAGATGGGAAAGGTTCTATTATTCGT 240


2922R-2.IR_full       241 AAAGGGCTTTACTCCTAGTGAACGCATNCAAGCTTGCGCGTATGACAGCGCTCTGGTTAG 300
                          ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||
2922R-2.in silico     241 AAAGGGCTTTACTCCTAGTGAACGCAT-CAAGCTTGCGCGTATGACAGCGCTCTGGTTAG 300


2922R-2.IR_full       301 TCAACGGTTCTGTACCGCCAAATGTTTTACTGGTACTAAACAACGAGCACCTAATCAAGG 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2922R-2.in silico     301 TCAACGGTTCTGTACCGCCAAATGTTTTACTGGTACTAAACAACGAGCACCTAATCAAGG 360


2922R-2.IR_full       361 ATGGCATTGCATTGGAGTTTCTACTAGAGCTGTTCCAGACGTTCAAGCAAGAGAAGGGCA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2922R-2.in silico     361 ATGGCATTGCATTGGAGTTTCTACTAGAGCTGTTCCAGACGTTCAAGCAAGAGAAGGGCA 420


2922R-2.IR_full       421 TTGCATATCTGATTCAGGCGCTTAAGAAGGGTGGACTGGAAAGCAAACTTATGGACTTTT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2922R-2.in silico     421 TTGCATATCTGATTCAGGCGCTTAAGAAGGGTGGACTGGAAAGCAAACTTATGGACTTTT 480


2922R-2.IR_full       481 TCCCACCGAACAAACGTACTG 501
                          |||||||||||||||||||||
2922R-2.in silico     481 TCCCACCGAACAAACGTACTG 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169074.1  CG2922-RA, transcript variant A (exba), mRNA 
100   482  NM_169079.1  CG2922-RF, transcript variant F (exba), mRNA 
100   482  NM_169076.1  CG2922-RC, transcript variant C (exba), mRNA 
100   482  NM_169077.1  CG2922-RD, transcript variant D (exba), mRNA 
100   482  NM_169075.1  CG2922-RB, transcript variant B (exba), mRNA 
100   482  NM_169078.1  CG2922-RE, transcript variant E (exba), mRNA 
100   482  NM_079514.2  CG2922-RG, transcript variant G (exba), mRNA 
0.2   NM_170197.1  CG7662-RB, transcript variant B (veli), mRNA 
0.2   NM_143073.2  CG7662-RA, transcript variant A (veli), mRNA 
0   NM_143638.2  CG2126-RA (CG2126), mRNA 
0   NM_139542.1  CG12009-RA (CG12009), mRNA 
0   NM_132429.2  CG2202-RA (CG2202), mRNA 
0   NM_206414.1  CG33288-RB (CG33288), mRNA 
0   NM_078509.2  CG3929-RA (dx), mRNA 
0   NM_079241.2  CG8114-RB, transcript variant B (pbl), mRNA 
0   NM_168243.1  CG8114-RD, transcript variant D (pbl), mRNA 
0   NM_166641.1  CG2987-RB, transcript variant B (alpha-catenin-related), mRNA 
0   NM_143816.2  CG2987-RA, transcript variant A (alpha-catenin-related), mRNA 
0   NM_135169.2  CG9493-RA (Pez), mRNA 
0   NM_142176.2  CG31344-RA (CG31344), mRNA 
0   NM_143293.2  CG14262-RA (CG14262), mRNA 
0   NM_143036.1  CG10951-RA (niki), mRNA 
0   NM_001031990.2  CG33936-RB, transcript variant B (CG33936), mRNA 
0   NM_001031991.2  CG33936-RA, transcript variant A (CG33936), mRNA 
0   NM_132347.1  CG3099-RB (CG3099), mRNA 
0   NM_001015257.1  CG17167-PA (CG17167), mRNA 
0   NM_001015256.1  CG17167-PB (CG17167), mRNA 
0   NM_143009.1  CG6607-RA (CG6607), mRNA 
0   NM_166865.2  CG32815-RA (CG32815), mRNA 
0   63  NM_175960.3  CG33196-RB (dp), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.