National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2747R-3 
 Symbol CG2747  Full Name CG2747 
 CG No CG2747  Old CG No CG2747 
 Synonyms CG2747 
 Accession No (Link to NCBI) NM_141504.1 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Le Bras S, Rondanino C, Kriegel-Taki G, Dussert A, Le Borgne R.
Genetic identification of intracellular trafficking regulators involved in Notch-dependent binary cell fate acquisition following asymmetric cell division.
J. Cell. Sci. (2012) 125(Pt 20) 4886-901 [ PubMed ID = 22825875 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   ACCAGGTCCGCCCATTCGTAAGCTCATTGCTAGCGCGTTGGCCACGCTATTCTCCGTTGG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  TGACACCTTCATGCTCTTCGACACCGTCAACGCCTGCAATGACATCCTGAAGAACAAGGA 120

                          ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 CGA-CTCGCCCAGCTACTTGCCCACAAAGCTTGCCGCCATTTGTGTGCTGGGCTCTATGT 180

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| silico     181 ATGAGAAGCTGGGCAGGATGATGGGCCGCACCTACGAGGATACGGTGCAGATCCTTATTC 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 GAACGCTTCGCAACGCTGAGTCGCAGGCGCGGATTGAGATCATGCACACGCTGGAGAAGG 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 TGAGCGCTGGCATGGGCACAGCCATTGCCAACGTGCACAAGGATATTTACAAGGCGGCCA 360

                          ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| silico     361 AGCATTGCCTGTTGGACCGAGTTATGGCTGTTCGA-GTGGCTGCAGCCCGCTGCATCCTT 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     421 AAAATGATATACAGTGCACCATTCCTGTACCAAACGGAGCTGGAAAGCTTGGGAACATTG 480

2747R-3.IR_full       481 TGTTTCCGAGCCTTCGACGGCA 502
                          |||||||||||||||||||||| silico     481 TGTTTCCGAGCCTTCGACGGCA 502

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169205.1  CG2747-RB, transcript variant B (CG2747), mRNA 
100   482  NM_141504.1  CG2747-RA, transcript variant A (CG2747), mRNA 
0.2   NM_136502.2  CG14762-RA (CG14762), mRNA 
0   NM_176292.1  CG10107-RB, transcript variant B (CG10107), mRNA 
0   NM_139799.3  CG10107-RA, transcript variant A (CG10107), mRNA 
0   NM_206286.1  CG10107-RC, transcript variant C (CG10107), mRNA 
0   18  NM_001032051.1  CG33715-RD, transcript variant D (Msp-300), mRNA 
0   NM_144380.1  CG3410-RA (lectin-24A), mRNA 
0   NM_134624.2  CG17598-RA (CG17598), mRNA 
0   NM_167095.1  CG32743-RA (Smg1), mRNA 
0   NM_142591.1  CG4770-RA (CG4770), mRNA 
0   NM_079972.3  CG4311-RA, transcript variant A (Hmgs), mRNA 
0   NM_166167.2  CG4311-RC, transcript variant C (Hmgs), mRNA 
0   NM_166166.2  CG4311-RB, transcript variant B (Hmgs), mRNA 
0   NM_166168.2  CG4311-RD, transcript variant D (Hmgs), mRNA 
0   NM_166169.2  CG4311-RE, transcript variant E (Hmgs), mRNA 
0   NM_140756.1  CG14586-RA (CG14586), mRNA 
0   NM_167525.1  CG9802-RB, transcript variant B (Cap), mRNA 
0   NM_078650.2  CG9802-RA, transcript variant A (Cap), mRNA 
0   NM_139705.1  CG10633-RA (CG10633), mRNA 
0   NM_168313.1  CG32031-RC, transcript variant C (Argk), mRNA 
0   NM_079264.2  CG32031-RD, transcript variant D (Argk), mRNA 
0   NM_168718.2  CG32169-RA (CG32169), mRNA 
0   NM_168312.1  CG32031-RB, transcript variant B (Argk), mRNA 
0   NM_168311.1  CG32031-RA, transcript variant A (Argk), mRNA 
0   NM_079771.1  CG11921-RA (fd96Ca), mRNA 
0   11  NM_080271.2  CG4625-RA (Dhap-at), mRNA 
0   NM_078578.2  CG1522-RA, transcript variant A (cac), mRNA 
0   NM_001014734.1  CG1522-RH, transcript variant H (cac), mRNA 
0   NM_001014733.1  CG1522-RI, transcript variant I (cac), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.