National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2675R-1 
 Symbol Csat  Full Name Csat 
 CG No CG2675  Old CG No CG2675 
 Synonyms UDP-Gal/UDP-GalNAc, CG2675, dNST-2, dNST-1, DmNST, DmUGT, CSAT, ugt, anon-3Bb, EG:100G10.5, unnamed, Csat 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCAGCTCCACGGCCGTACTCA 
 Primer Seq. 3'
aatctagaggtaccCGCGAATCCGGAGAGGAAGCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

2675R-1.IR full       1   TCAGCTCCACGGCCGTACTCATGGCAGAGTTCGCCAAACTGATCACGTGCCTGTTCCTGG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2675R-1.in silico     1   TCAGCTCCACGGCCGTACTCATGGCAGAGTTCGCCAAACTGATCACGTGCCTGTTCCTGG 60


2675R-1.IR full       61  TCTTCAACGAGGAGGGCAAGGATGCCCAGAAGTTTGTACGCTCGCTTCACAAGACAATCA 120
                          |||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||
2675R-1.in silico     61  TCTTCAACGAGGAGGGCAAGGATGCCCAGAAGTTTGTACGCTCGCTGCACAAGACCATCA 120


2675R-1.IR full       121 TTGCGAATCCCATGGACACGCTGAAGGTGTGCGTTCCCTCGCTGGTCTATATCGTTCAAA 180
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
2675R-1.in silico     121 TTGCGAATCCCATGGACACGCTGAAGGTGTGCGTCCCCTCGCTGGTCTATATCGTTCAAA 180


2675R-1.IR full       181 ACAATCTGCTGTACGTCTCTGCCTCCCATTTGGATGCGGCCACCTACCAGGTGACGTACC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2675R-1.in silico     181 ACAATCTGCTGTACGTCTCTGCCTCCCATTTGGATGCGGCCACCTACCAGGTGACGTACC 240


2675R-1.IR full       241 AGCTGAAGATTCTCACCACGGCCATGTTCGCGGTTGTCATTCTGCGCCGCAAGCTGCTGA 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2675R-1.in silico     241 AGCTGAAGATTCTCACCACGGCCATGTTCGCGGTTGTCATTCTGCGCCGCAAGCTGCTGA 300


2675R-1.IR full       301 ACACGCAGTGGGGTGCGCTGCTGCTCCTGGTGATGGGCATCGTCCTGGTGCAGTTGGCCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2675R-1.in silico     301 ACACGCAGTGGGGTGCGCTGCTGCTCCTGGTGATGGGCATCGTCCTGGTGCAGTTGGCCC 360


2675R-1.IR full       361 AAACGGAGGGTCCGACGAGTGGCTCAGCCGGTGGAGCCGCAGCTGCAGCCACGGCCGCCT 420
                          |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||
2675R-1.in silico     361 AAACGGAGGGTCCGACGAGTGGCTCAGCCGGTGGTGCCGCAGCTGCAGCCACGGCCGCCT 420


2675R-1.IR full       421 CCTCTGGCGGTGCTCCCGAGCAGAACAGGATGCTCGGACTGTGGGCCGCACTGGGCGCCT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2675R-1.in silico     421 CCTCTGGCGGTGCTCCCGAGCAGAACAGGATGCTCGGACTGTGGGCCGCACTGGGCGCCT 480


2675R-1.IR full       481 GCTTCCTCTCCGGATTCGC- 500
                          ||||||||||||||||||| 
2675R-1.in silico     481 GCTTCCTCTCCGGATTCGCG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  472  NM_130663.2  Csat CG2675-RA (Csat), mRNA 
NM_144182.1  dpr6 CG14162-RA (dpr6), mRNA 
NM_057847.3  Angiotensin-converting enzyme-related CG10593-RA (Acer), mRNA 
NM_136090.2  CG15173-RA (CG15173), mRNA 
NM_132938.2  CG4789-RA (CG4789), mRNA 
12  NM_139420.1  CG12361-RA (CG12361), mRNA 
NM_136128.1  CG13083-RA, transcript variant A (CG13083), mRNA 
NM_206005.1  CG13083-RB, transcript variant B (CG13083), mRNA 
12  NM_001043144.1  CG4998-RB, transcript variant B (CG4998), mRNA 
NM_140621.1  CG4998-RA, transcript variant A (CG4998), mRNA 
NM_134895.2  CG3605-RA (CG3605), mRNA 
NM_142924.2  CG10219-RA (CG10219), mRNA 
NM_079470.2  Adenylyl cyclase 78C CG10564-RA (Ac78C), mRNA 
NM_170082.1  CG10251-RA (CG10251), mRNA 
14  NM_078662.2  BarH2 CG5488-RA (B-H2), mRNA 
10  NM_134727.2  CG4577-RA (CG4577), mRNA 
NM_137832.1  CG4554-RA (CG4554), mRNA 
16  NM_079507.2  corto CG2530-RA (corto), mRNA 
NM_001043051.1  Down syndrome cell adhesion molecule CG17800-PAP (Dscam), mRNA 
NM_001043023.1  Down syndrome cell adhesion molecule CG17800-PAQ (Dscam), mRNA 
NM_001043027.1  Down syndrome cell adhesion molecule CG17800-PAR (Dscam), mRNA 
NM_001043019.1  Down syndrome cell adhesion molecule CG17800-PAS (Dscam), mRNA 
NM_078925.5  Down syndrome cell adhesion molecule CG17800-RD, transcript variant D (Dscam), mRNA 
NM_001043021.1  Down syndrome cell adhesion molecule CG17800-PAT (Dscam), mRNA 
NM_001043032.1  Down syndrome cell adhesion molecule CG17800-PAY (Dscam), mRNA 
NM_001043039.1  Down syndrome cell adhesion molecule CG17800-PAV (Dscam), mRNA 
NM_001043017.1  Down syndrome cell adhesion molecule CG17800-PAW (Dscam), mRNA 
NM_001043015.1  Down syndrome cell adhesion molecule CG17800-PAX (Dscam), mRNA 
NM_001043055.1  Down syndrome cell adhesion molecule CG17800-RL, transcript variant L (Dscam), mRNA 
NM_001043044.1  Down syndrome cell adhesion molecule CG17800-RM, transcript variant M (Dscam), mRNA 
100  482  NM_130663.2  Csat CG2675-RA (Csat), mRNA 
NM_137456.2  CG5733-RA (CG5733), mRNA 
NM_170359.1  CG5508-RB, transcript variant B (CG5508), mRNA 
NM_170358.1  CG5508-RC, transcript variant C (CG5508), mRNA 
NM_143340.2  CG5508-RA, transcript variant A (CG5508), mRNA 
14  NM_131924.2  CG4857-RB (CG4857), mRNA 
NM_136910.1  CG13165-RA (CG13165), mRNA 
24  NM_079507.2  corto CG2530-RA (corto), mRNA 
20  NM_078662.2  BarH2 CG5488-RA (B-H2), mRNA 
NM_137832.1  CG4554-RA (CG4554), mRNA 
NM_133104.2  CG7282-RA (CG7282), mRNA 
NM_078681.2  CCK-like receptor at 17D3 CG32540-RA (CCKLR-17D3), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.