National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2666R-1 
 Symbol kkv  Full Name krotzkopf verkehrt 
 CG No CG2666  Old CG No CG2666 
 Synonyms kkv, CS-1/kkv, blimp, ChSB, DmeChSB, DmCS-1, l(3)82Fh, CS-1, CG2666, Kkv 
 Accession No (Link to NCBI)  
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCACGTCGACAGCGATGACA 
 Primer Seq. 3'
aatctagaggtaccCATCAGCCAGACGAAGAGGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

2666R-1.IR full       1   GAGCACGTCGACAGCGATGACAACAACTTTACCGACGACGAGAGCTCGCCCCTCACCCAC 60
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2666R-1.in silico     1   -AGCACGTCGACAGCGATGACAACAACTTTACCGACGACGAGAGCTCGCCCCTCACCCAC 60


2666R-1.IR full       61  GACATTTACGGCGGCAGCCAACGCACCATACAAGAGACGAAGGGTTGGGATGTTTTCCGG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2666R-1.in silico     61  GACATTTACGGCGGCAGCCAACGCACCATACAAGAGACGAAGGGTTGGGATGTTTTCCGG 120


2666R-1.IR full       121 GATCCGCCAATCAAAATTGAGACCGGATCGACGGCGAACCAGGAATGCTTAGAATTAACC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2666R-1.in silico     121 GATCCGCCAATCAAAATTGAGACCGGATCGACGGCGAACCAGGAATGCTTAGAATTAACC 180


2666R-1.IR full       181 GTGAAGATCTTGAAGATCTTCGCCTATGTGATTACGTTTATAATAGTTTTAACCGGTGGC 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2666R-1.in silico     181 GTGAAGATCTTGAAGATCTTCGCCTATGTGATTACGTTTATAATAGTTTTAACCGGTGGC 240


2666R-1.IR full       241 GTCATCGCCAAGGGCACAATGCTCTTCATNGACTTCGCAGGTGCGCAAGGATAAGAAGAT 300
                          |||||||||||||||||||||||||||||  |||||||||||||||||||||||||||||
2666R-1.in silico     241 GTCATCGCCAAGGGCACAATGCTCTTCATG-ACTTCGCAGGTGCGCAAGGATAAGAAGAT 300


2666R-1.IR full       301 GGAGTACTGCAACAAAGACTTGGGTCGGGACAAAAGCTTCGTAGTCCGACTTCCGGAGGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2666R-1.in silico     301 GGAGTACTGCAACAAAGACTTGGGTCGGGACAAAAGCTTCGTAGTCCGACTTCCGGAGGA 360


2666R-1.IR full       361 GGAGCGAGTGGCCTGGATCTGGGCTCTGCTCATAGCATATGCCCTTCCCGAGATCGGAGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2666R-1.in silico     361 GGAGCGAGTGGCCTGGATCTGGGCTCTGCTCATAGCATATGCCCTTCCCGAGATCGGAGC 420


2666R-1.IR full       421 CTTGATCCGATCCGCCCGCATCTGCTTCTTCAAGACCTTTAAGGTGCCGAAGACGGGCCA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2666R-1.in silico     421 CTTGATCCGATCCGCCCGCATCTGCTTCTTCAAGACCTTTAAGGTGCCGAAGACGGGCCA 480


2666R-1.IR full       481 CTTCCTCTTCGTCTGGCTGATG 502
                          ||||||||||||||||||||||
2666R-1.in silico     481 CTTCCTCTTCGTCTGGCTGATG 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_206430.1  krotzkopf verkehrt CG2666-RC, transcript variant C (kkv), mRNA 
100  482  NM_079509.1  krotzkopf verkehrt CG2666-RA, transcript variant A (kkv), mRNA 
100  482  NM_169052.1  krotzkopf verkehrt CG2666-RB, transcript variant B (kkv), mRNA 
NM_132041.2  CG15765-RA (CG15765), mRNA 
NM_169038.1  l(3)82Fd CG32464-RJ, transcript variant J (l(3)82Fd), mRNA 
NM_001031977.1  l(3)82Fd CG32464-RN, transcript variant N (l(3)82Fd), mRNA 
NM_001043213.1  l(3)82Fd CG32464-RP, transcript variant P (l(3)82Fd), mRNA 
NM_143760.2  l(3)82Fd CG32464-RB, transcript variant B (l(3)82Fd), mRNA 
NM_169039.2  l(3)82Fd CG32464-RL, transcript variant L (l(3)82Fd), mRNA 
NM_140933.1  CG7017-RA (CG7017), mRNA 
NM_058006.3  Hsp70/Hsp90 organizing protein homolog CG2720-RA (Hop), mRNA 
NM_166013.1  CG30485-RA (CG30485), mRNA 
NM_137051.1  CG13337-RA (CG13337), mRNA 
NM_130500.2  CG5254-RA (CG5254), mRNA 
NM_168162.1  Bestrophin 2 CG10173-RA (Best2), mRNA 
NM_080165.1  betaTrypsin CG18211-RA (betaTry), mRNA 
NM_057423.3  alphaTrypsin CG18444-RA (alphaTry), mRNA 
NM_079659.2  cheerio CG3937-RA, transcript variant A (cher), mRNA 
NM_206502.1  cheerio CG3937-RD, transcript variant D (cher), mRNA 
NM_167924.1  CG13937-RC, transcript variant C (CG13937), mRNA 
NM_167923.1  CG13937-RB, transcript variant B (CG13937), mRNA 
NR_002693.1  CR15280, mRNA 
NM_143797.1  CG17829-RA, transcript variant A (CG17829), mRNA 
NM_166852.1  CG17829-RC, transcript variant C (CG17829), mRNA 
NM_166851.1  CG17829-RB, transcript variant B (CG17829), mRNA 
NM_132000.2  CG12730-RA (CG12730), mRNA 
NM_164313.1  CG12581-RB, transcript variant B (CG12581), mRNA 
NM_169882.1  CG4836-RB, transcript variant B (CG4836), mRNA 
NM_169883.1  CG4836-RA, transcript variant A (CG4836), mRNA 
NM_141178.3  CG12581-RA, transcript variant A (CG12581), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.