National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2647R-1 
 Symbol per  Full Name period 
 CG No CG2647  Old CG No CG2647 
 Synonyms PER, dper, EG:155E2.4, CG2647, dPER, Per, Clk, clk-6, per, unamed 
 Accession No (Link to NCBI) NM_080317.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
[Please submit your publication]
Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.<br> DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.<br> Dev Biol (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]

Sakai T, Inami S, Sato S, Kitamoto T.<br> Fan-shaped body neurons are involved in period-dependent regulation of long-term courtship memory in Drosophila.<br> Learn Mem (2012) 19(12) 571-4 [ PubMed ID = 23154928 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   AAGGAGGACAGCTTCTGCTGCGTCATCTCCATGCACGACGGCATCGTCCTGTACACGACG 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  CCCAGCATCACCGATGTCCTGGGCTACCCGCGCGACATGTGGCTGGGCAGGTCCTTCATC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 GATTTTGTGCACCTTAAGGACCGCGCCACCTTCGCCAGTCAGATCACCACGGGCATACCC 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATTGCGGAATCCAGGGGCAGCGTGCCCAAGGACGCCAAGAGCACCTTCTGCGTGATGCTG 240

                           ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico      241 GTCGCTACCGGGGACTCAAGTCCGGCGGATTCGGCGTCATCGGCAGGCCCGTCAGCTAC 299

2647R-1.IR_full       301 GAACCCTT<span class="snp"><tt>N</tt></span>CGCCTGGGGCTCACCTTCAGGGAGGC<span class="snp"><tt>N</tt></span>CCGGAGGAGGCGCGACCGGACAAC 359
                          ||||||||<span class="snp"><tt>&nbsp;</tt></span>||||||||||||||||||||||||||<span class="snp"><tt>&nbsp;</tt></span>|||||||||||||||||||||||| silico     301 GAACCCTT<span class="snp"><tt>C</tt></span>CGCCTGGGGCTCACCTTCAGGGAGGC<span class="snp"><tt>T</tt></span>CCGGAGGAGGCGCGACCGGACAAC 359

                          |||||||||||||||||||||||||||||||||||||||||||||||<span class="snp"><tt>&nbsp;</tt></span>|||||||||||| silico     361 TACATGGTCTCCAATGGCACCAACATGCTGCTCGTCATCTGCGCCAC<span class="snp"><tt>T</tt></span>CCGATCAAGAGC 419

                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||<span class="snp"><tt>&nbsp;</tt></span>||| silico     421 AGCTACAAGGTTCCCGACGAGATTCTCTCACAGAAGAGCCCCAAGTTCGCCATACG<span class="snp"><tt>C</tt></span>CAC 479

2647R-1.IR_full       481 ACGGCCACCGGGATCATATC 499
                          |||||||||||||||||||| silico     481 ACGGCCACCGGGATCATATC 499

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080317.2  CG2647-RA (per), mRNA 
0   NM_165849.1  CG8983-RA, transcript variant A (ERp60), mRNA 
0   NM_136866.2  CG8983-RB, transcript variant B (ERp60), mRNA 
0   NM_135443.3  CG3759-RA (CG3759), mRNA 
0   NM_139396.3  CG2069-RA (Oseg4), mRNA 
0   NM_142831.2  CG4813-RA (CG4813), mRNA 
0   NM_079930.2  CG3856-RB, transcript variant B (Oamb), mRNA 
0   NM_168448.1  CG32082-RA (CG32082), mRNA 
0   NM_169844.1  CG31149-RA (CG31149), mRNA 
0   NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_206147.1  CG9635-RE, transcript variant E (RhoGEF2), mRNA 
0   NM_206146.1  CG9635-RF, transcript variant F (RhoGEF2), mRNA 
0   NM_057969.3  CG9635-RD, transcript variant D (RhoGEF2), mRNA 
0   NM_166130.1  CG18255-RE, transcript variant E (Strn-Mlck), mRNA 
0   NM_079273.2  CG4183-RA (Hsp26), mRNA 
0   NM_057244.3  CG10501-RA, transcript variant A (amd), mRNA 
0   NM_080097.2  CG6699-RA (beta'Cop), mRNA 
0   NM_001038778.1  CG3662-RB, transcript variant B (CG3662), mRNA 
0   NM_057738.3  CG3969-RA, transcript variant A (PR2), mRNA 
0   NM_057739.3  CG3969-RB, transcript variant B (PR2), mRNA 
0   NM_136601.1  CG8197-RA (CG8197), mRNA 
0   NM_134705.2  CG3662-RA, transcript variant A (CG3662), mRNA 
0   NM_166694.1  CG9047-RC, transcript variant C (CG9047), mRNA 
0   NM_166693.1  CG9047-RB, transcript variant B (CG9047), mRNA 
0   NM_138131.2  CG9047-RA, transcript variant A (CG9047), mRNA 
0   NM_139723.1  CG17795-RA, transcript variant A (mthl2), mRNA 
0   NM_176284.1  CG17795-RB, transcript variant B (mthl2), mRNA 
0   NM_079677.2  CG6027-RA (cdi), mRNA 
 Pathways (updated: 2024/04/26)
 KEGG Pathway dme04711 : Circadian rhythm - fly

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.