National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2647R-1 
 Symbol per  Full Name period 
 CG No CG2647  Old CG No CG2647 
 Synonyms PER, dper, EG:155E2.4, CG2647, dPER, Per, Clk, clk-6, per, unamed 
 Accession No (Link to NCBI) NM_080317.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Sakai T, Inami S, Sato S, Kitamoto T.
Fan-shaped body neurons are involved in period-dependent regulation of long-term courtship memory in Drosophila.
Learn. Mem. (2012) 19(12) 571-4 [ PubMed ID = 23154928 ] [ RRC reference ]

Nitta Y, Yamazaki D, Sugie A, Hiroi M, Tabata T.
DISCO Interacting Protein 2 regulates axonal bifurcation and guidance of Drosophila mushroom body neurons.
Dev. Biol. (2017) 421(2) 233-244 [ PubMed ID = 27908785 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAAGGAGGACAGCTTCTGCTGC 
 Primer Seq. 3'
aatctagaggtaccGATATGATCCCGGTGGCCGTG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AAGGAGGACA GCTTCTGCTG CGTCATCTCC ATGCACGACG GCATCGTCCT GTACACGACG 
0061 CCCAGCATCA CCGATGTCCT GGGCTACCCG CGCGACATGT GGCTGGGCAG GTCCTTCATC 
0121 GATTTTGTGC ACCTTAAGGA CCGCGCCACC TTCGCCAGTC AGATCACCAC GGGCATACCC 
0181 ATTGCGGAAT CCAGGGGCAG CGTGCCCAAG GACGCCAAGA GCACCTTCTG CGTGATGCTG 
0241 NGTCGCTACC GGGGACTCAA GTCCGGCGGA TTCGGCGTCA TCGGCAGGCC CGTCAGCTAC 
0301 GAACCCTTNC gCCTGGGGCT CACCTTCAGG GAGGcNCCGG AGGAGGCGCG ACCGGACAAC 
0361 TACATGGTCT CCAATGGCAC CAACATGCTG CTCGTCATCT GCGCCACNCC GATCAAGAGC 
0421 AGCTACAAGG TTCCCGACGA GATTCTCTCA CAGAAGAGCC CCAAGTTCGC CATACgNCAC 
0481 ACGGCCACCG GGATCATATC  
 in silico PCR Fragment
0001 AAGGAGGACA GCTTCTGCTG CGTCATCTCC ATGCACGACG GCATCGTCCT GTACACGACG 
0061 CCCAGCATCA CCGATGTCCT GGGCTACCCG CGCGACATGT GGCTGGGCAG GTCCTTCATC 
0121 GATTTTGTGC ACCTTAAGGA CCGCGCCACC TTCGCCAGTC AGATCACCAC GGGCATACCC 
0181 ATTGCGGAAT CCAGGGGCAG CGTGCCCAAG GACGCCAAGA GCACCTTCTG CGTGATGCTG 
0241 CGTCGCTACC GGGGACTCAA GTCCGGCGGA TTCGGCGTCA TCGGCAGGCC CGTCAGCTAC 
0301 GAACCCTTCC GCCTGGGGCT CACCTTCAGG GAGGCTCCGG AGGAGGCGCG ACCGGACAAC 
0361 TACATGGTCT CCAATGGCAC CAACATGCTG CTCGTCATCT GCGCCACTCC GATCAAGAGC 
0421 AGCTACAAGG TTCCCGACGA GATTCTCTCA CAGAAGAGCC CCAAGTTCGC CATACGCCAC 
0481 ACGGCCACCG GGATCATATC  
 Assemble Data

2647R-1.IR_full       1   AAGGAGGACAGCTTCTGCTGCGTCATCTCCATGCACGACGGCATCGTCCTGTACACGACG 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2647R-1.in silico     1   AAGGAGGACAGCTTCTGCTGCGTCATCTCCATGCACGACGGCATCGTCCTGTACACGACG 60


2647R-1.IR_full       61  CCCAGCATCACCGATGTCCTGGGCTACCCGCGCGACATGTGGCTGGGCAGGTCCTTCATC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2647R-1.in silico     61  CCCAGCATCACCGATGTCCTGGGCTACCCGCGCGACATGTGGCTGGGCAGGTCCTTCATC 120


2647R-1.IR_full       121 GATTTTGTGCACCTTAAGGACCGCGCCACCTTCGCCAGTCAGATCACCACGGGCATACCC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2647R-1.in silico     121 GATTTTGTGCACCTTAAGGACCGCGCCACCTTCGCCAGTCAGATCACCACGGGCATACCC 180


2647R-1.IR_full       181 ATTGCGGAATCCAGGGGCAGCGTGCCCAAGGACGCCAAGAGCACCTTCTGCGTGATGCTG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2647R-1.in silico     181 ATTGCGGAATCCAGGGGCAGCGTGCCCAAGGACGCCAAGAGCACCTTCTGCGTGATGCTG 240


2647R-1.IR_full        241 GTCGCTACCGGGGACTCAAGTCCGGCGGATTCGGCGTCATCGGCAGGCCCGTCAGCTAC 299
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2647R-1.in silico      241 GTCGCTACCGGGGACTCAAGTCCGGCGGATTCGGCGTCATCGGCAGGCCCGTCAGCTAC 299


2647R-1.IR_full       301 GAACCCTTNCGCCTGGGGCTCACCTTCAGGGAGGCNCCGGAGGAGGCGCGACCGGACAAC 359
                          |||||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||
2647R-1.in silico     301 GAACCCTTCCGCCTGGGGCTCACCTTCAGGGAGGCTCCGGAGGAGGCGCGACCGGACAAC 359


2647R-1.IR_full       361 TACATGGTCTCCAATGGCACCAACATGCTGCTCGTCATCTGCGCCACNCCGATCAAGAGC 419
                          ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||
2647R-1.in silico     361 TACATGGTCTCCAATGGCACCAACATGCTGCTCGTCATCTGCGCCACTCCGATCAAGAGC 419


2647R-1.IR_full       421 AGCTACAAGGTTCCCGACGAGATTCTCTCACAGAAGAGCCCCAAGTTCGCCATACGNCAC 479
                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||
2647R-1.in silico     421 AGCTACAAGGTTCCCGACGAGATTCTCTCACAGAAGAGCCCCAAGTTCGCCATACGCCAC 479


2647R-1.IR_full       481 ACGGCCACCGGGATCATATC 499
                          ||||||||||||||||||||
2647R-1.in silico     481 ACGGCCACCGGGATCATATC 499

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_080317.2  CG2647-RA (per), mRNA 
0   NM_165849.1  CG8983-RA, transcript variant A (ERp60), mRNA 
0   NM_136866.2  CG8983-RB, transcript variant B (ERp60), mRNA 
0   NM_135443.3  CG3759-RA (CG3759), mRNA 
0   NM_139396.3  CG2069-RA (Oseg4), mRNA 
0   NM_142831.2  CG4813-RA (CG4813), mRNA 
0   NM_079930.2  CG3856-RB, transcript variant B (Oamb), mRNA 
0   NM_168448.1  CG32082-RA (CG32082), mRNA 
0   NM_169844.1  CG31149-RA (CG31149), mRNA 
0   NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_166129.2  CG18255-RD, transcript variant D (Strn-Mlck), mRNA 
0   NM_206147.1  CG9635-RE, transcript variant E (RhoGEF2), mRNA 
0   NM_206146.1  CG9635-RF, transcript variant F (RhoGEF2), mRNA 
0   NM_057969.3  CG9635-RD, transcript variant D (RhoGEF2), mRNA 
0   NM_166130.1  CG18255-RE, transcript variant E (Strn-Mlck), mRNA 
0   NM_079273.2  CG4183-RA (Hsp26), mRNA 
0   NM_057244.3  CG10501-RA, transcript variant A (amd), mRNA 
0   NM_080097.2  CG6699-RA (beta'Cop), mRNA 
0   NM_001038778.1  CG3662-RB, transcript variant B (CG3662), mRNA 
0   NM_057738.3  CG3969-RA, transcript variant A (PR2), mRNA 
0   NM_057739.3  CG3969-RB, transcript variant B (PR2), mRNA 
0   NM_136601.1  CG8197-RA (CG8197), mRNA 
0   NM_134705.2  CG3662-RA, transcript variant A (CG3662), mRNA 
0   NM_166694.1  CG9047-RC, transcript variant C (CG9047), mRNA 
0   NM_166693.1  CG9047-RB, transcript variant B (CG9047), mRNA 
0   NM_138131.2  CG9047-RA, transcript variant A (CG9047), mRNA 
0   NM_139723.1  CG17795-RA, transcript variant A (mthl2), mRNA 
0   NM_176284.1  CG17795-RB, transcript variant B (mthl2), mRNA 
0   NM_079677.2  CG6027-RA (cdi), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.