National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2615R-1 
 Symbol ik2  Full Name IkappaB kinase-like 2 
 CG No CG2615  Old CG No CG2615 
 Synonyms ik2, l(2)38Ea, DmIKKepsilon, APTX7, CG2615, IKKepsilon, Ik2, Ik2/DmIKK, dIKK, IK2, 38D.31, DmIKKepsilon/dIK2, Dmik2, DIK2, dik2, Dik2 
 Accession No (Link to NCBI) NM_136204.2 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Oshima K, Takeda M, Kuranaga E, Ueda R, Aigaki T, Miura M, Hayashi S.
IKK epsilon regulates F actin assembly and interacts with Drosophila IAP1 in cellular morphogenesis.
Curr. Biol. (2006) 16(15) 1531-7 [ PubMed ID = 16887350 ] [ RRC reference ]

Parsons LM, Grzeschik NA, Amaratunga K, Burke P, Quinn LM, Richardson HE.
A Kinome RNAi Screen in Drosophila Identifies Novel Genes Interacting with Lgl, aPKC, and Crb Cell Polarity Genes in Epithelial Tissues.
G3 (Bethesda) (2017) 7(8) 2497-2509 [ PubMed ID = 28611255 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGTGTTCCAGGGGGTCAACAAG 
 Primer Seq. 3'
aatctagaggtaccACAGCGCGCTCGTAGAGATCG 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NTGTTCCAGG GGGTCAACAA GATCACCGGC GAATCGGTGG CGGTGAAGAC CTTTAATCCC 
0061 TACAGTCACA TGCGACCGGC TGATGTGCAG ATGCGGGAGT TCGAGGCCCT GAAGAAGGTC 
0121 AACCACGAGA ATATAGTAAA GCTGTTGGCG ATCGAGGAGG ATCAAGAGGG GCGTGGTAAG 
0181 GTGATCGTGA TGGAGCTCTG CACAGGCGGA AGTCTCTTTA ACATCCTGGA CGATCCTGAG 
0241 AACTCGTACG GTCTGCCGGA ACACGAGTTC CTGCTGGTCT TGGAACACTT GTGCGCCGGA 
0301 ATGAAGCACT TGCGGGATAA CAANGCTGGT GCATCGCGAT CTGAAGCCCG GAAACATAAT 
0361 GAAGTTCATC TCGGAGGACG GGCAAACCAT ATACAAGCTT ACTGATTTCG GTGCTGCTAG 
0421 AGAACTGGAG GATAATCAGC CGTTTGCCTC TCTATACGGC ACAGAAGAGT ATCTTCATCC 
0481 CGATCTCTAC GAGCGCGCTG T 
 in silico PCR Fragment
0001 GTGTTCCAGG GGGTCAACAA GATCACCGGC GAATCGGTGG CGGTGAAGAC CTTTAATCCC 
0061 TACAGTCACA TGCGACCGGC TGATGTGCAG ATGCGGGAGT TCGAGGCCCT GAAAAAGGTC 
0121 AACCACGAGA ATATAGTAAA GCTGTTGGCG ATCGAGGAGG ATCAAGAGGG GCGTGGTAAG 
0181 GTGATCGTGA TGGAGCTCTG CACAGGCGGA AGTCTCTTTA ACATCCTGGA CGATCCTGAG 
0241 AACTCGTACG GTCTGCCGGA ACACGAGTTC CTGCTGGTCT TGGAACACTT GTGCGCCGGA 
0301 ATGAAGCACT TGCGGGATAA CAA-GCTGGT GCATCGCGAT CTGAAGCCCG GAAACATAAT 
0361 GAAGTTCATC TCGGAGGACG GGCAAACCAT ATACAAGCTT ACTGATTTCG GTGCTGCTAG 
0421 AGAACTGGAG GATAATCAGC CGTTTGCCTC TCTATACGGC ACAGAAGAGT ATCTTCATCC 
0481 CGATCTCTAC GAGCGCGCTG T 
 Assemble Data

2615R-1.IR_full        1   TGTTCCAGGGGGTCAACAAGATCACCGGCGAATCGGTGGCGGTGAAGACCTTTAATCCC 59
                           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2615R-1.in silico      1   TGTTCCAGGGGGTCAACAAGATCACCGGCGAATCGGTGGCGGTGAAGACCTTTAATCCC 59


2615R-1.IR_full       61  TACAGTCACATGCGACCGGCTGATGTGCAGATGCGGGAGTTCGAGGCCCTGAAGAAGGTC 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||
2615R-1.in silico     61  TACAGTCACATGCGACCGGCTGATGTGCAGATGCGGGAGTTCGAGGCCCTGAAAAAGGTC 119


2615R-1.IR_full       121 AACCACGAGAATATAGTAAAGCTGTTGGCGATCGAGGAGGATCAAGAGGGGCGTGGTAAG 179
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2615R-1.in silico     121 AACCACGAGAATATAGTAAAGCTGTTGGCGATCGAGGAGGATCAAGAGGGGCGTGGTAAG 179


2615R-1.IR_full       181 GTGATCGTGATGGAGCTCTGCACAGGCGGAAGTCTCTTTAACATCCTGGACGATCCTGAG 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2615R-1.in silico     181 GTGATCGTGATGGAGCTCTGCACAGGCGGAAGTCTCTTTAACATCCTGGACGATCCTGAG 239


2615R-1.IR_full       241 AACTCGTACGGTCTGCCGGAACACGAGTTCCTGCTGGTCTTGGAACACTTGTGCGCCGGA 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2615R-1.in silico     241 AACTCGTACGGTCTGCCGGAACACGAGTTCCTGCTGGTCTTGGAACACTTGTGCGCCGGA 299


2615R-1.IR_full       301 ATGAAGCACTTGCGGGATAACAANGCTGGTGCATCGCGATCTGAAGCCCGGAAACATAAT 359
                          ||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||
2615R-1.in silico     301 ATGAAGCACTTGCGGGATAACAA-GCTGGTGCATCGCGATCTGAAGCCCGGAAACATAAT 359


2615R-1.IR_full       361 GAAGTTCATCTCGGAGGACGGGCAAACCATATACAAGCTTACTGATTTCGGTGCTGCTAG 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2615R-1.in silico     361 GAAGTTCATCTCGGAGGACGGGCAAACCATATACAAGCTTACTGATTTCGGTGCTGCTAG 419


2615R-1.IR_full       421 AGAACTGGAGGATAATCAGCCGTTTGCCTCTCTATACGGCACAGAAGAGTATCTTCATCC 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2615R-1.in silico     421 AGAACTGGAGGATAATCAGCCGTTTGCCTCTCTATACGGCACAGAAGAGTATCTTCATCC 479


2615R-1.IR_full       481 CGATCTCTACGAGCGCGCTGT 500
                          |||||||||||||||||||||
2615R-1.in silico     481 CGATCTCTACGAGCGCGCTGT 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_165337.1  CG2615-RB, transcript variant B (ik2), mRNA 
100   482  NM_136204.2  CG2615-RA, transcript variant A (ik2), mRNA 
0.2   NM_167015.2  CG6998-RC, transcript variant C (ctp), mRNA 
0.2   NM_080336.3  CG6998-RA, transcript variant A (ctp), mRNA 
0.2   NM_167016.1  CG6998-RD, transcript variant D (ctp), mRNA 
0.2   NM_167014.1  CG6998-RB, transcript variant B (ctp), mRNA 
0   11  NM_166125.2  CG18255-RA, transcript variant A (Strn-Mlck), mRNA 
0   NM_166128.1  CG18255-RG, transcript variant G (Strn-Mlck), mRNA 
0   NM_166126.1  CG18255-RC, transcript variant C (Strn-Mlck), mRNA 
0   NM_166127.1  CG18255-RF, transcript variant F (Strn-Mlck), mRNA 
0   NM_079030.2  CG18255-RB, transcript variant B (Strn-Mlck), mRNA 
0   NM_135226.2  CG11221-RA (CG11221), mRNA 
0   NM_136670.2  CG1776-RA (CG1776), mRNA 
0   NM_057687.3  CG4488-RA (wee), mRNA 
0   NM_206620.4  CG32782-RD, transcript variant D (tlk), mRNA 
0   NM_130717.3  CG32782-RC, transcript variant C (tlk), mRNA 
0   NM_137515.1  CG15072-RA (CG15072), mRNA 
0   NM_079696.4  CG10498-RB, transcript variant B (cdc2c), mRNA 
0   NM_169916.1  CG10498-RA, transcript variant A (cdc2c), mRNA 
0   NM_164806.1  CG7795-RB, transcript variant B (CG7795), mRNA 
0   NM_135364.1  CG7795-RA, transcript variant A (CG7795), mRNA 
0   NM_135357.3  CG8183-RA, transcript variant A (Khc-73), mRNA 
0   NM_176176.1  CG8183-RB, transcript variant B (Khc-73), mRNA 
0   NM_079464.2  CG3354-RA (Mst77F), mRNA 
0   NM_165490.1  CG3427-RA (Epac), mRNA 
0   NM_057732.3  CG8203-RA (Cdk5), mRNA 
0   NM_141401.1  CG2330-RA (CG2330), mRNA 
0   NM_141453.2  CG1234-RA (CG1234), mRNA 
0   NM_140583.1  CG12272-RA (CG12272), mRNA 
0   NM_057373.2  CG2822-RA, transcript variant A (Shaw), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.