National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock discarded request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2590R-2 
 Symbol Ten-a  Full Name Tenascin accessory 
 CG No CG32659  Old CG No CG2590 
 Synonyms ten[a], CG2578, Dmtena, ten-a, tenA(AT)[[14]], 1.2, Ten[a], tenA, unnamed, CG18182, CG2590, Ten11A, CG11270, CG32659, Ten-a, DmtenA 
 Accession No (Link to NCBI) NM_078582.3 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
[Please submit your publication]
Hong W, Mosca TJ, Luo L.
Teneurins instruct synaptic partner matching in an olfactory map.
Nature (2012) 484(7393) 201-7 [ PubMed ID = 22425994 ] [ RRC reference ]  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
 Primer Seq. 3'
 Predicted Fragment Size
 IR fragment full Seq
 in silico PCR Fragment
 Assemble Data

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     1   TCGATGTGCTGGTGAATGGCGGCGGAGCGGTGACCTTGCAGTTCCAGCGCTCCCCCTTCC 60

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     61  GACCTTTGACCCGTACCGTCTTTGTGCCCTGGAACCGGATCGTGGTCCTGCCGCCCGTGC 120

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     121 AAATGCAGCTCAGCGACGACGACGAGACGACCAGCAGGAATATCAAAGTGGCTCCACTAA 180

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     181 ATCCCGCCCTGACGTTCCTCAACTCGATCCACTATCACACGGCGGACGAGGCCAACGATG 240

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     241 CCAGCAAGGTGTGCATGGATCACGACCACGAGAAGCTGCGTCCCCAGCTGATCAGCACCT 300

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     301 GGATGCCCAACGGAGTGGGCGCCATGCCCGGCAAAAGGGTCATCTTTGCCGAGACTCAGA 360

                          |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| silico     361 TCGTCCAAGAATCCATCCAGATTCCGGGCTCGGACCTCCACCTCACCTATCAGTCCTCGC 420

                          |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| silico     421 AGGCCAGTGGCTATCTGAGCATAGTGCGTATGCGCCTAACCGGCGAAACGATACCGCCCA 480

2590R-2.IR_full       481 CTCTGACCCACGTGCATGTG 500
                          |||||||||||||||||||| silico     481 CTCTGACCCACGTGCATGTG 500

 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  16  NM_078582.3  CG32659-RA (Ten-a), mRNA 
0   NM_140865.1  CG9295-RB (CG9295), mRNA 
0   NM_135145.1  CG9144-RA (CG9144), mRNA 
0   NM_057832.3  CG5393-RA, transcript variant A (apt), mRNA 
0   NM_166609.1  CG5393-RC, transcript variant C (apt), mRNA 
0   NM_057831.3  CG5393-RB, transcript variant B (apt), mRNA 
0   NM_166611.1  CG5393-RE, transcript variant E (apt), mRNA 
0   NM_166610.1  CG5393-RD, transcript variant D (apt), mRNA 
0   NM_130644.1  CG14049-RA (Ilp6), mRNA 
0   NM_164688.1  CG31640-RA (CG31640), mRNA 
0   NM_135550.1  CG5362-RA (CG5362), mRNA 
0   NM_132676.2  CG12175-RB (tth), mRNA 
0   NM_079676.2  CG6009-RA (P5cr), mRNA 
0   NM_140067.1  CG3654-RD (CG3654), mRNA 
0   NM_132260.2  CG12113-RA (l(1)G0095), mRNA 
0   NM_164944.1  CG31869-RA (CG31869), mRNA 
0   NM_137830.1  CG3701-RA (CG3701), mRNA 
0   NM_205912.1  CG11020-RB, transcript variant B (nompC), mRNA 
0   NM_078759.2  CG11020-RA, transcript variant A (nompC), mRNA 
0   NM_136635.2  CG2078-RA (Myd88), mRNA 
0   NM_132522.2  CG32662-RA (CG32662), mRNA 
0   NM_079715.2  CG13418-RA (RpI12), mRNA 
0   NM_136386.2  CG3409-RA (CG3409), mRNA 
0   NM_140751.2  CG32190-RA (NUCB1), mRNA 
0   NM_136515.2  CG8709-RA (CG8709), mRNA 
0   NM_140299.1  CG6910-RA (CG6910), mRNA 
0   16  NM_130640.1  CG2879-RA (CG2879), mRNA 
0   NM_166546.2  CG30092-RD, transcript variant D (jbug), mRNA 
0   NM_166548.2  CG30092-RB, transcript variant B (jbug), mRNA 
0   NM_132953.1  CG13001-RA (CG13001), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.