National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2590R-1 
 Symbol Ten-a  Full Name Tenascin accessory 
 CG No CG32659  Old CG No CG2590 
 Synonyms ten[a], CG2578, Dmtena, ten-a, tenA(AT)[[14]], 1.2, Ten[a], tenA, unnamed, CG18182, CG2590, Ten11A, CG11270, CG32659, Ten-a, DmtenA 
 Accession No (Link to NCBI) NM_078582.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees viable 
 Map Viewer
 Reference
[Please submit your publication]
Hong W, Mosca TJ, Luo L.
Teneurins instruct synaptic partner matching in an olfactory map.
Nature (2012) 484(7393) 201-7 [ PubMed ID = 22425994 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgTCGATGTGCTGGTGAATGGCG 
 Primer Seq. 3'
aatctagaggtaccCACATGCACGTGGGTCAGAGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 TCGATGTGCT GGTGAATGGC GGCGGAGCGG TGACCTTGCA GTTCCAGCGC TCCCCCTTCC 
0061 GACCTTTGAC CCGTACCGTC TTTGTGCCCT GGAACCGGAT CGTGGTCCTG CCGCCCGTGC 
0121 AAATGCAGCT CAGCGACGAC GACGAGACGA CCAGCAGGAA TATCAAAGTG GCTCCACTAA 
0181 ATCCCGCCCT GACGTTCCTC AACTCGATCC ACTATCACAC GGCGGACGAG GCCAACGATG 
0241 CCAGCAAGGT GTGCATGGAT CACGACCACG AGAAGCTGCG TCCCCAGCTG ATCAGCACCT 
0301 GGATGCCCAA CGGAGTGGGC GCCATGCCCG GCAAAAGGGT CATCTTTGCC GAGACTCAGA 
0361 TCGTCCAAGA ATCCATCCAG ATTCCGGGCT CGGACCTCCA CCTCACCTAT CAGTCCTCGC 
0421 AGGCCAGTGG CTATCTGAGC ATAGTGCGTA TGcGCCTAAC CGGCGAAACG ATTCCGCCCA 
0481 CTCTGACCCA CGTGCATGTG  
 in silico PCR Fragment
0001 TCGATGTGCT GGTGAATGGC GGCGGAGCGG TGACCTTGCA GTTCCAGCGC TCCCCCTTCC 
0061 GACCTTTGAC CCGTACCGTC TTTGTGCCCT GGAACCGGAT CGTGGTCCTG CCGCCCGTGC 
0121 AAATGCAGCT CAGCGACGAC GACGAGACGA CCAGCAGGAA TATCAAAGTG GCTCCACTAA 
0181 ATCCCGCCCT GACGTTCCTC AACTCGATCC ACTATCACAC GGCGGACGAG GCCAACGATG 
0241 CCAGCAAGGT GTGCATGGAT CACGACCACG AGAAGCTGCG TCCCCAGCTG ATCAGCACCT 
0301 GGATGCCCAA CGGAGTGGGC GCCATGCCCG GCAAAAGGGT CATCTTTGCC GAGACTCAGA 
0361 TCGTCCAAGA ATCCATCCAG ATTCCGGGCT CGGACCTCCA CCTCACCTAT CAGTCCTCGC 
0421 AGGCCAGTGG CTATCTGAGC ATAGTGCGTA TGCGCCTAAC CGGCGAAACG ATACCGCCCA 
0481 CTCTGACCCA CGTGCATGTG  
 Assemble Data

2590R-1.IR_full       1   TCGATGTGCTGGTGAATGGCGGCGGAGCGGTGACCTTGCAGTTCCAGCGCTCCCCCTTCC 60
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2590R-1.in silico     1   TCGATGTGCTGGTGAATGGCGGCGGAGCGGTGACCTTGCAGTTCCAGCGCTCCCCCTTCC 60


2590R-1.IR_full       61  GACCTTTGACCCGTACCGTCTTTGTGCCCTGGAACCGGATCGTGGTCCTGCCGCCCGTGC 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2590R-1.in silico     61  GACCTTTGACCCGTACCGTCTTTGTGCCCTGGAACCGGATCGTGGTCCTGCCGCCCGTGC 120


2590R-1.IR_full       121 AAATGCAGCTCAGCGACGACGACGAGACGACCAGCAGGAATATCAAAGTGGCTCCACTAA 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2590R-1.in silico     121 AAATGCAGCTCAGCGACGACGACGAGACGACCAGCAGGAATATCAAAGTGGCTCCACTAA 180


2590R-1.IR_full       181 ATCCCGCCCTGACGTTCCTCAACTCGATCCACTATCACACGGCGGACGAGGCCAACGATG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2590R-1.in silico     181 ATCCCGCCCTGACGTTCCTCAACTCGATCCACTATCACACGGCGGACGAGGCCAACGATG 240


2590R-1.IR_full       241 CCAGCAAGGTGTGCATGGATCACGACCACGAGAAGCTGCGTCCCCAGCTGATCAGCACCT 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2590R-1.in silico     241 CCAGCAAGGTGTGCATGGATCACGACCACGAGAAGCTGCGTCCCCAGCTGATCAGCACCT 300


2590R-1.IR_full       301 GGATGCCCAACGGAGTGGGCGCCATGCCCGGCAAAAGGGTCATCTTTGCCGAGACTCAGA 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2590R-1.in silico     301 GGATGCCCAACGGAGTGGGCGCCATGCCCGGCAAAAGGGTCATCTTTGCCGAGACTCAGA 360


2590R-1.IR_full       361 TCGTCCAAGAATCCATCCAGATTCCGGGCTCGGACCTCCACCTCACCTATCAGTCCTCGC 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2590R-1.in silico     361 TCGTCCAAGAATCCATCCAGATTCCGGGCTCGGACCTCCACCTCACCTATCAGTCCTCGC 420


2590R-1.IR_full       421 AGGCCAGTGGCTATCTGAGCATAGTGCGTATGCGCCTAACCGGCGAAACGATTCCGCCCA 480
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
2590R-1.in silico     421 AGGCCAGTGGCTATCTGAGCATAGTGCGTATGCGCCTAACCGGCGAAACGATACCGCCCA 480


2590R-1.IR_full       481 CTCTGACCCACGTGCATGTG 500
                          ||||||||||||||||||||
2590R-1.in silico     481 CTCTGACCCACGTGCATGTG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  16  NM_078582.3  CG32659-RA (Ten-a), mRNA 
0   NM_140865.1  CG9295-RB (CG9295), mRNA 
0   NM_135145.1  CG9144-RA (CG9144), mRNA 
0   NM_057832.3  CG5393-RA, transcript variant A (apt), mRNA 
0   NM_166609.1  CG5393-RC, transcript variant C (apt), mRNA 
0   NM_057831.3  CG5393-RB, transcript variant B (apt), mRNA 
0   NM_166611.1  CG5393-RE, transcript variant E (apt), mRNA 
0   NM_166610.1  CG5393-RD, transcript variant D (apt), mRNA 
0   NM_130644.1  CG14049-RA (Ilp6), mRNA 
0   NM_164688.1  CG31640-RA (CG31640), mRNA 
0   NM_135550.1  CG5362-RA (CG5362), mRNA 
0   NM_132676.2  CG12175-RB (tth), mRNA 
0   NM_079676.2  CG6009-RA (P5cr), mRNA 
0   NM_140067.1  CG3654-RD (CG3654), mRNA 
0   NM_132260.2  CG12113-RA (l(1)G0095), mRNA 
0   NM_164944.1  CG31869-RA (CG31869), mRNA 
0   NM_137830.1  CG3701-RA (CG3701), mRNA 
0   NM_205912.1  CG11020-RB, transcript variant B (nompC), mRNA 
0   NM_078759.2  CG11020-RA, transcript variant A (nompC), mRNA 
0   NM_136635.2  CG2078-RA (Myd88), mRNA 
0   NM_132522.2  CG32662-RA (CG32662), mRNA 
0   NM_079715.2  CG13418-RA (RpI12), mRNA 
0   NM_136386.2  CG3409-RA (CG3409), mRNA 
0   NM_140751.2  CG32190-RA (NUCB1), mRNA 
0   NM_136515.2  CG8709-RA (CG8709), mRNA 
0   NM_140299.1  CG6910-RA (CG6910), mRNA 
0   16  NM_130640.1  CG2879-RA (CG2879), mRNA 
0   NM_166546.2  CG30092-RD, transcript variant D (jbug), mRNA 
0   NM_166548.2  CG30092-RB, transcript variant B (jbug), mRNA 
0   NM_132953.1  CG13001-RA (CG13001), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.