National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2534R-3 
 Symbol cno  Full Name canoe 
 CG No CG2534  Old CG No CG2534 
 Synonyms Cno, Canoe, lip, mis, dlhA, CG2534, anon-WO0172774.47, cno, AF-6 
 Accession No (Link to NCBI) NM_079508.2 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Ma Z, Li P, Hu X, Song H.
Polarity protein Canoe mediates overproliferation via modulation of JNK, Ras-MAPK and Hippo signalling.
Cell Prolif (2019) 52(1) e12529 [ PubMed ID = 30328653 ] [ RRC reference ]

Umemori M, Habara O, Iwata T, Maeda K, Nishinoue K, Okabe A, Takemura M, Takahashi K, Saigo K, Ueda R, Adachi-Yamada T.
RNAi-mediated knockdown showing impaired cell survival in Drosophila wing imaginal disc.
Gene Regul Syst Bio (2009) 3 11-20 [ PubMed ID = 19838331 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgGATGTTGGATCGCGAGGCAGT 
 Primer Seq. 3'
aatctagaggtaccAGGTGGGCGGATCAGAGCTCA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 NATGTTGGAT CGCGAGGCAG TACGCTNCAG TGATACAGCA ATGGAATGCC AATCGATTGG 
0061 ATCTATTTGC TCTCTCCGAG CCAGACGAGA ACCTGCTCTT CCATGGCGTT ATGCGCTTCT 
0121 ACTTCCAAGA TGCTGGCCAG AAAGTGGCCA CCAAATGCAT NTCGCGTGGC TTCCGATGCC 
0181 ACTGTCACAG ATGTCATAGA CACACTCATT GAGAAATTCC GTCCCGATAT GCGGATGCTA 
0241 TCCGTGCCCA ACTACGCCCT TTACGAAGTG CACGCCAATG GCGAGGAGCG TCGTCTCAAT 
0301 GCCGACGAGA NAGCCACTGC TGGTGCAGCT GAATTGGCAT ATTGACGATC GCGAAGGTCG 
0361 ATTCCTGCTC AAGAACATAG ACCAAAAGAC CACTCCCATC GAGCAGACAG ATCTAAACTT 
0421 TAAGAGAAAA CTTTCGAAGC GAGAGAAAAA GGAGCAGAAG AAAAAGGAGA AGATgGCAAA 
0481 GCTGAGCTCT GATCCGCCCA CCT 
 in silico PCR Fragment
0001 GATGTTGGAT CGCGAGGCAG TACGCT-CAG TGATACAGCA ATGGAATGCC AATCGATTGG 
0061 ATCTATTTGC TCTCTCCGAG CCAGACGAGA ACCTGCTCTT CCATGGCGTT ATGCGCTTCT 
0121 ACTTCCAAGA TGCTGGCCAG AAAGTGGCCA CCAAATGCAT -TCGCGTGGC TTCCGATGCC 
0181 ACTGTCACAG ATGTCATAGA CACACTCATT GAGAAATTCC GTCCCGATAT GCGGATGCTA 
0241 TCCGTGCCCA ACTACGCCCT TTACGAAGTG CACGCCAATG GCGAGGAGCG TCGTCTCAAT 
0301 GCCGACGAGA -AGCCACTGC TGGTGCAGCT GAATTGGCAT ATTGACGATC GCGAAGGTCG 
0361 ATTCCTGCTC AAGAACATAG ACCAAAAGAC CACTCCCATC GAGCAGACAG ATCTAAACTT 
0421 TAAGAGAAAA CTTTCGAAGC GAGAGAAAAA GGAGCAGAAG AAAAAGGAGA AGATGGCAAA 
0481 GCTGAGCTCT GATCCGCCCA CCT 
 Assemble Data

2534R-3.IR_full        1   ATGTTGGATCGCGAGGCAGTACGCTNCAGTGATACAGCAATGGAATGCCAATCGATTGG 59
                           ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||
2534R-3.in silico      1   ATGTTGGATCGCGAGGCAGTACGCT-CAGTGATACAGCAATGGAATGCCAATCGATTGG 59


2534R-3.IR_full       61  ATCTATTTGCTCTCTCCGAGCCAGACGAGAACCTGCTCTTCCATGGCGTTATGCGCTTCT 119
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2534R-3.in silico     61  ATCTATTTGCTCTCTCCGAGCCAGACGAGAACCTGCTCTTCCATGGCGTTATGCGCTTCT 119


2534R-3.IR_full       121 ACTTCCAAGATGCTGGCCAGAAAGTGGCCACCAAATGCATNTCGCGTGGCTTCCGATGCC 179
                          |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
2534R-3.in silico     121 ACTTCCAAGATGCTGGCCAGAAAGTGGCCACCAAATGCAT-TCGCGTGGCTTCCGATGCC 179


2534R-3.IR_full       181 ACTGTCACAGATGTCATAGACACACTCATTGAGAAATTCCGTCCCGATATGCGGATGCTA 239
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2534R-3.in silico     181 ACTGTCACAGATGTCATAGACACACTCATTGAGAAATTCCGTCCCGATATGCGGATGCTA 239


2534R-3.IR_full       241 TCCGTGCCCAACTACGCCCTTTACGAAGTGCACGCCAATGGCGAGGAGCGTCGTCTCAAT 299
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2534R-3.in silico     241 TCCGTGCCCAACTACGCCCTTTACGAAGTGCACGCCAATGGCGAGGAGCGTCGTCTCAAT 299


2534R-3.IR_full       301 GCCGACGAGANAGCCACTGCTGGTGCAGCTGAATTGGCATATTGACGATCGCGAAGGTCG 359
                          |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||
2534R-3.in silico     301 GCCGACGAGA-AGCCACTGCTGGTGCAGCTGAATTGGCATATTGACGATCGCGAAGGTCG 359


2534R-3.IR_full       361 ATTCCTGCTCAAGAACATAGACCAAAAGACCACTCCCATCGAGCAGACAGATCTAAACTT 419
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2534R-3.in silico     361 ATTCCTGCTCAAGAACATAGACCAAAAGACCACTCCCATCGAGCAGACAGATCTAAACTT 419


2534R-3.IR_full       421 TAAGAGAAAACTTTCGAAGCGAGAGAAAAAGGAGCAGAAGAAAAAGGAGAAGATGGCAAA 479
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2534R-3.in silico     421 TAAGAGAAAACTTTCGAAGCGAGAGAAAAAGGAGCAGAAGAAAAAGGAGAAGATGGCAAA 479


2534R-3.IR_full       481 GCTGAGCTCTGATCCGCCCACCT 502
                          |||||||||||||||||||||||
2534R-3.in silico     481 GCTGAGCTCTGATCCGCCCACCT 502

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169025.1  CG2534-RB, transcript variant B (cno), mRNA 
100   482  NM_079508.2  CG2534-RA, transcript variant A (cno), mRNA 
0.62   NM_132961.2  CG4955-RA (CG4955), mRNA 
0.2   NM_137344.2  CG30456-RA (CG30456), mRNA 
0   10  NM_137194.1  CG8179-RA (CG8179), mRNA 
0   NM_001042993.1  CG17082-RB, transcript variant B (CG17082), mRNA 
0   NM_001042989.1  CG17082-RA, transcript variant A (CG17082), mRNA 
0   NM_001042991.1  CG17082-RF, transcript variant F (CG17082), mRNA 
0   NM_001042994.1  CG17082-RE, transcript variant E (CG17082), mRNA 
0   NM_001042992.1  CG17082-RD, transcript variant D (CG17082), mRNA 
0   NM_001042990.1  CG17082-RC, transcript variant C (CG17082), mRNA 
0   NM_132560.2  CG1924-RA (CG1924), mRNA 
0   NM_132125.1  CG4536-RA (CG4536), mRNA 
0   13  NM_167090.1  CG14438-RB, transcript variant B (CG14438), mRNA 
0   13  NM_132120.1  CG14438-RA, transcript variant A (CG14438), mRNA 
0   NM_170253.2  CG8318-RB, transcript variant B (Nf1), mRNA 
0   NM_170252.2  CG8318-RC, transcript variant C (Nf1), mRNA 
0   NM_001014668.1  CG8318-RD, transcript variant D (Nf1), mRNA 
0   NM_170559.1  CG1775-RB, transcript variant B (Med), mRNA 
0   NM_079871.2  CG1775-RA, transcript variant A (Med), mRNA 
0   NM_001031935.1  CG32258-RB, transcript variant B (Gr64e), mRNA 
0   NM_168051.2  CG32258-RA, transcript variant A (Gr64e), mRNA 
0   NM_168050.2  CG14987-RA, transcript variant A (Gr64d), mRNA 
0   NM_136864.2  CG13185-RA (CG13185), mRNA 
0   NM_080088.1  CG6577-RA (can), mRNA 
0   NM_169585.1  CG8087-RA (CG8087), mRNA 
0   NM_141313.1  CG2182-RA, transcript variant A (CG2182), mRNA 
0   NM_169090.1  CG2182-RB, transcript variant B (CG2182), mRNA 
0   10  11  NM_080381.2  CG3333-RA, transcript variant A (Nop60B), mRNA 
0   10  11  NM_001014547.1  CG3333-RB, transcript variant B (Nop60B), mRNA 
 Wing Disc
GFP
Puc
Caspase
DAPI
Merge
Figure
JNK signal
N
 
DB
+- 
DC
++ 
DM
+- 
VM
 
VB
 
Caspase-3 signal
N
DB
++ 
DC
++ 
DM
++ 
VM
VB
 
Dcompartment   Penetrance
   

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.