National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2509R-2 
 Symbol CG31547  Full Name CG31547 
 CG No CG31547  Old CG No CG2509 
 Synonyms CG2509, CG10544, CG31547 
 Accession No (Link to NCBI) NM_169058.1 
 Inserted Chr. ll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees lethal 
 Map Viewer
 Reference
[Please submit your publication]
Buhl E, Bradlaugh A, Ogueta M, Chen KF, Stanewsky R, Hodge JJ.
Quasimodo mediates daily and acute light effects on Drosophila clock neuron excitability.
Proc. Natl. Acad. Sci. U.S.A. (2016) 113(47) 13486-13491 [ PubMed ID = 27821737 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGCATCACTATTCCCGAACCC 
 Primer Seq. 3'
aatctagaggtaccTTCGTCTCCCACTCCATACCC 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGCATCACTA TTCCCGAACC CGAACCGgaG GCAACTGGCG GACACATCAA GCATAGGATG 
0061 GATCGTGGGC GTGCTGATAC CTTGCCTTCT CAACATCTGG GGCGTAATGC TCTTCCTGCG 
0121 CCTCAGCTGG GTGGTGGCCG AGTCGGGCAT CCTGCAGTCC CTGATTATAA TTACGATCTC 
0181 CGCGGTGGTC TGCGTCATCA CGACGCTCTC GCTGTCGGCC ATTAGCACCA ACGGCGAGGT 
0241 CAAGGGCGGC GGCGTCTACT TCATCATATC CCGTTCGCTG GGCCCCGAGT TTGGGGCGTC 
0301 GGTGGGCGTG GTCTTCGCCT TCGCCAACGC CGTCTCAGCC TCGATGAACA CCATCGGCTT 
0361 CTGCGAATCG CTAAATGTTT TACTCAAGAA CAACGACCTG AAGATTGTCG ACAACGGGAT 
0421 CAATGACATC CGGATCGTGG GATCGATAAC CGTGCTGGTG CTCATCCTAA TCTGCTGCGT 
0481 GGGTATGGAG TGGGAGACGA A 
 in silico PCR Fragment
0001 AGCATCACTA TTCCCGAACC CGAACCGGAG GCAACTGGCG GACACATCAA GC-TAGGATG 
0061 GATCGTGGGC GTGCTGATAC CTTGCCTTCT CAACATCTGG GGCGTAATGC TCTTCCTGCG 
0121 CCTCAGCTGG GTGGTGGCCG AGTCGGGCAT CCTGCAGTCC CTGATTATAA TTACGATCTC 
0181 CGCGGTGGTC TGCGTCATCA CGACGCTCTC GCTGTCGGCC ATTAGCACCA ACGGCGAGGT 
0241 CAAGGGCGGC GGCGTCTACT TCATCATATC CCGTTCGCTG GGCCCCGAGT TTGGGGCGTC 
0301 GGTGGGCGTG GTCTTCGCCT TCGCCAACGC CGTCTCAGCC TCGATGAACA CCATCGGCTT 
0361 CTGCGAATCG CTAAATGTTT TACTCAAGAA CAACGACCTG AAGATTGTCG ACAACGGGAT 
0421 CAATGACATC CGGATCGTGG GATCGATAAC CGTGCTGGTG CTCATCCTAA TCTGCTGCGT 
0481 GGGTATGGAG TGGGAGACGA A 
 Assemble Data

2509R-2.IR_full       1   AGCATCACTATTCCCGAACCCGAACCGGAGGCAACTGGCGGACACATCAAGCATAGGATG 60
                          |||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||
2509R-2.in silico     1   AGCATCACTATTCCCGAACCCGAACCGGAGGCAACTGGCGGACACATCAAGC-TAGGATG 60


2509R-2.IR_full       61  GATCGTGGGCGTGCTGATACCTTGCCTTCTCAACATCTGGGGCGTAATGCTCTTCCTGCG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2509R-2.in silico     61  GATCGTGGGCGTGCTGATACCTTGCCTTCTCAACATCTGGGGCGTAATGCTCTTCCTGCG 120


2509R-2.IR_full       121 CCTCAGCTGGGTGGTGGCCGAGTCGGGCATCCTGCAGTCCCTGATTATAATTACGATCTC 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2509R-2.in silico     121 CCTCAGCTGGGTGGTGGCCGAGTCGGGCATCCTGCAGTCCCTGATTATAATTACGATCTC 180


2509R-2.IR_full       181 CGCGGTGGTCTGCGTCATCACGACGCTCTCGCTGTCGGCCATTAGCACCAACGGCGAGGT 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2509R-2.in silico     181 CGCGGTGGTCTGCGTCATCACGACGCTCTCGCTGTCGGCCATTAGCACCAACGGCGAGGT 240


2509R-2.IR_full       241 CAAGGGCGGCGGCGTCTACTTCATCATATCCCGTTCGCTGGGCCCCGAGTTTGGGGCGTC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2509R-2.in silico     241 CAAGGGCGGCGGCGTCTACTTCATCATATCCCGTTCGCTGGGCCCCGAGTTTGGGGCGTC 300


2509R-2.IR_full       301 GGTGGGCGTGGTCTTCGCCTTCGCCAACGCCGTCTCAGCCTCGATGAACACCATCGGCTT 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2509R-2.in silico     301 GGTGGGCGTGGTCTTCGCCTTCGCCAACGCCGTCTCAGCCTCGATGAACACCATCGGCTT 360


2509R-2.IR_full       361 CTGCGAATCGCTAAATGTTTTACTCAAGAACAACGACCTGAAGATTGTCGACAACGGGAT 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2509R-2.in silico     361 CTGCGAATCGCTAAATGTTTTACTCAAGAACAACGACCTGAAGATTGTCGACAACGGGAT 420


2509R-2.IR_full       421 CAATGACATCCGGATCGTGGGATCGATAACCGTGCTGGTGCTCATCCTAATCTGCTGCGT 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2509R-2.in silico     421 CAATGACATCCGGATCGTGGGATCGATAACCGTGCTGGTGCTCATCCTAATCTGCTGCGT 480


2509R-2.IR_full       481 GGGTATGGAGTGGGAGACGAA 501
                          |||||||||||||||||||||
2509R-2.in silico     481 GGGTATGGAGTGGGAGACGAA 501

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_169057.1  CG31547-RB, transcript variant B (CG31547), mRNA 
100   482  NM_169058.1  CG31547-RA, transcript variant A (CG31547), mRNA 
0.2   NM_140053.2  CG3967-RC, transcript variant C (CG3967), mRNA 
0.2   NM_170630.1  CG3967-RD, transcript variant D (CG3967), mRNA 
0.2   NM_170631.1  CG3967-RE, transcript variant E (CG3967), mRNA 
0.2   NM_140052.1  CG3967-RA, transcript variant A (CG3967), mRNA 
0   23  35  NM_206344.1  CG4357-RB, transcript variant B (Ncc69), mRNA 
0   23  35  NM_140315.3  CG4357-RA, transcript variant A (Ncc69), mRNA 
0   NM_167632.1  CG6900-RA (CG6900), mRNA 
0   NM_141468.1  CG1287-RA (CG1287), mRNA 
0   NM_133003.2  CG32555-RB, transcript variant B (RhoGAPp190), mRNA 
0   NM_167573.1  CG32555-RC, transcript variant C (RhoGAPp190), mRNA 
0   NM_167572.1  CG32555-RA, transcript variant A (RhoGAPp190), mRNA 
0   NM_133108.2  CG32542-RA (CG32542), mRNA 
0   NM_141993.2  CG7518-RB, transcript variant B (CG7518), mRNA 
0   NM_169489.1  CG7518-RA, transcript variant A (CG7518), mRNA 
0   NM_132115.1  CG14440-RA (CG14440), mRNA 
0   NM_132016.1  CG15778-RA (CG15778), mRNA 
0   NM_058154.3  CG10060-RA (G-ialpha65A), mRNA 
0   NM_169576.1  CG31321-RB (CG31321), mRNA 
0   NM_139798.2  CG32393-RA, transcript variant A (dikar), mRNA 
0   NM_206285.1  CG32393-RB, transcript variant B (dikar), mRNA 
0   NM_168134.1  CG5505-RC, transcript variant C (mule), mRNA 
0   NM_168133.1  CG5505-RF, transcript variant F (mule), mRNA 
0   NM_168135.1  CG5505-RB, transcript variant B (mule), mRNA 
0   NM_139729.2  CG5505-RE, transcript variant E (mule), mRNA 
0   NM_168131.1  CG5505-RA, transcript variant A (mule), mRNA 
0   NM_168132.1  CG5505-RD, transcript variant D (mule), mRNA 
0   NM_143739.2  CG18321-RA (miple2), mRNA 
0   NM_142864.1  CG17110-RA (CG17110), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.