National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2448R-1 
 Symbol FucT6  Full Name alpha1,6-fucosyltransferase 
 CG No CG2448  Old CG No CG2448 
 Synonyms Fuc-TVIII, CG2448, CK00490, BEST:CK00490, FucT6, Dm alpha1,6-FucT 
 Accession No (Link to NCBI)  
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees early pupal lethal 
 Map Viewer
 Reference
[Please submit your publication]
Yamamoto-Hino M, Yoshida H, Ichimiya T, Sakamura S, Maeda M, Kimura Y, Sasaki N, Aoki-Kinoshita KF, Kinoshita-Toyoda A, Toyoda H, Ueda R, Nishihara S, Goto S.
Phenotype-based clustering of glycosylation-related genes by RNAi-mediated gene silencing.
Genes Cells (2015) 20(6) 521-42 [ PubMed ID = 25940448 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgCTGCTGGTGCGTCAGCTATTC 
 Primer Seq. 3'
aatctagaggtaccCCGATGTTCGTCTGGATGCGT 
 Predicted Fragment Size
500 
 IR fragment full Seq
 
 in silico PCR Fragment
 
 Assemble Data

2448R-1.IR full       1   CTGCTGGTGCGTCAGCTATTCGGGGCTTCGGCCAACTNCCTGGCACGCGCCCTCATCATA 60
                          ||||||||||||||||||||||||||||||||||||| |  |||||||||||||||||||
2448R-1.in silico     1   CTGCTGGTGCGTCAGCTATTCGGGGCTTCGGCCAACTCCTGGGCACGCGCCCTCATCATA 60


2448R-1.IR full       61  TTCGTACTGGCCTGGATCGGGTTGGTCTACGTGTTCGTGGTCAAGCTGACCAATACTCAG 120
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2448R-1.in silico     61  TTCGTACTGGCCTGGATCGGGTTGGTCTACGTGTTCGTGGTCAAGCTGACCAATACTCAG 120


2448R-1.IR full       121 GGCCAGCAGGCGGCCGGGGAGAGTGAGCTGAANGCCCGTCGCATATCACAGGCGCTCCAG 180
                          |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
2448R-1.in silico     121 GGCCAGCAGGCGGCCGGGGAGAGTGAGCTGAACGCCCGTCGCATATCACAGGCGCTCCAG 180


2448R-1.IR full       181 ATGCTGGAGCACACGAGACAGCGCAATGAGGAGCTTAAACAGCTCATCGACGAGTTGATG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2448R-1.in silico     181 ATGCTGGAGCACACGAGACAGCGCAATGAGGAGCTTAAACAGCTCATCGACGAGTTGATG 240


2448R-1.IR full       241 AGTGACCAACTGGACAAGCAGAGCGCAATGAAACTGGTGCAAAGGCTGGAGAACGATGCG 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2448R-1.in silico     241 AGTGACCAACTGGACAAGCAGAGCGCAATGAAACTGGTGCAAAGGCTGGAGAACGATGCG 300


2448R-1.IR full       301 CTAAATCCAAAGCTGGCGCCCGAGGTCGCCGGCCCGGAACCAGAATCCATGTTCGAGTCC 360
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2448R-1.in silico     301 CTAAATCCAAAGCTGGCGCCCGAGGTCGCCGGCCCGGAACCAGAATCCATGTTCGAGTCC 360


2448R-1.IR full       361 GCCCCCGCTGATCTGCGCGGTTGGAATAATGTGGCCGAGGGAGCGCCCAATGATCTGGAG 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2448R-1.in silico     361 GCCCCCGCTGATCTGCGCGGTTGGAATAATGTGGCCGAGGGAGCGCCCAATGATCTGGAG 420


2448R-1.IR full       421 GCCGGTGTTCCGGATCATGGCGAATTCGAGCCCAGCCTAGAGTACGAGTTCACGCGCAGA 480
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2448R-1.in silico     421 GCCGGTGTTCCGGATCATGGCGAATTCGAGCCCAGCCTAGAGTACGAGTTCACGCGCAGA 480


2448R-1.IR full       481 CGCATCCAGACGAACATCGG 500
                          ||||||||||||||||||||
2448R-1.in silico     481 CGCATCCAGACGAACATCGG 500

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100  482  NM_132512.2  FucT6 CG2448-RA (FucT6), mRNA 
0.2  NM_165887.1  CG30047-RA (CG30047), mRNA 
11  NM_166992.2  echinus CG2904-RA (ec), mRNA 
NM_167752.1  sluggish A CG1417-RD, transcript variant D (slgA), mRNA 
NM_078709.2  sluggish A CG1417-RE, transcript variant E (slgA), mRNA 
NM_206804.1  sluggish A CG1417-RG, transcript variant G (slgA), mRNA 
NM_206805.1  sluggish A CG1417-RF, transcript variant F (slgA), mRNA 
NM_167753.1  sluggish A CG1417-RB, transcript variant B (slgA), mRNA 
NM_167751.1  sluggish A CG1417-RA, transcript variant A (slgA), mRNA 
NM_206803.1  sluggish A CG1417-RH, transcript variant H (slgA), mRNA 
NM_167754.1  sluggish A CG1417-RC, transcript variant C (slgA), mRNA 
NM_143497.2  CG7896-RA (CG7896), mRNA 
NM_079873.3  fat facets CG1945-RA, transcript variant A (faf), mRNA 
NM_170576.1  fat facets CG1945-RC, transcript variant C (faf), mRNA 
NM_001032018.1  CG33747-RB, transcript variant B (primo-2), mRNA 
NM_001032017.1  CG33747-RC, transcript variant C (primo-2), mRNA 
NM_001032016.1  CG33748-RA, transcript variant A (primo-1), mRNA 
NM_001032015.1  CG33748-RB, transcript variant B (primo-1), mRNA 
NM_001032014.1  CG33748-RC, transcript variant C (primo-1), mRNA 
NM_140918.1  CG14185-RA (CG14185), mRNA 
NM_078930.2  Diacyl glycerol kinase CG18654-RA, transcript variant A (Dgk), mRNA 
NM_165568.1  Diacyl glycerol kinase CG18654-RB, transcript variant B (Dgk), mRNA 
NM_206053.1  Diacyl glycerol kinase CG18654-RD, transcript variant D (Dgk), mRNA 
10  NM_136913.2  CG17739-RA (CG17739), mRNA 
NM_170639.1  CG17122-RA (CG17122), mRNA 
NM_132932.2  CG9634-RA (CG9634), mRNA 
NM_057657.4  capping protein beta CG17158-RA (cpb), mRNA 
NM_140067.1  CG3654-RD (CG3654), mRNA 
NM_132634.2  CG12096-RA (CG12096), mRNA 
NM_001043307.1  CG34133-RA, transcript variant A (CG34133), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.