National Institute of Genetics
Contact us      Quick Search       
NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -NIG-Fly - Fly Stocks of National Institute of Genetics (NIG) Drosophila strain -
Home Home
Japanese | English  
NIG-RNAi Strains Detail
Request : Click the "Order" button to request for this stock   request request_help.gif
Stock Detail (Last Update: November 2007_FlyBase version FB2007_11)
 Stock ID 2411R-1 
 Symbol ptc  Full Name patched 
 CG No CG2411  Old CG No CG2411 
 Synonyms ptc, Ptc, Ptc_Dm, l(2)k02507, rubr, PTC, tuf, pat, Conf, CG2411, BcDNA:RH36596, ptch, Ptch 
 Accession No (Link to NCBI) NM_078937.3 
 Inserted Chr. lll 
 Insertional Mutation   
 Phenotype induced by Act5C-GAL4 at 28 degrees larval lethal 
 Map Viewer
 Reference
[Please submit your publication]
Lv X, Pan C, Zhang Z, Xia Y, Chen H, Zhang S, Guo T, Han H, Song H, Zhang L, Zhao Y.
SUMO regulates somatic cyst stem cell maintenance and directly targets the Hedgehog pathway in adult Drosophila testis.
Development (2016) 143(10) 1655-62 [ PubMed ID = 27013244 ] [ RRC reference ]

Yavari A, Nagaraj R, Owusu-Ansah E, Folick A, Ngo K, Hillman T, Call G, Rohatgi R, Scott MP, Banerjee U.
Role of lipid metabolism in smoothened derepression in hedgehog signaling.
Dev. Cell (2010) 19(1) 54-65 [ PubMed ID = 20643350 ] [ RRC reference ]

Lee G, Liang C, Park G, Jang C, Jung JU, Chung J.
UVRAG is required for organ rotation by regulating Notch endocytosis in Drosophila.
Dev. Biol. (2011) 356(2) 588-97 [ PubMed ID = 21729695 ] [ RRC reference ]

Zhang Z, Lv X, Jiang J, Zhang L, Zhao Y.
Dual roles of Hh signaling in the regulation of somatic stem cell self-renewal and germline stem cell maintenance in Drosophila testis.
Cell Res. (2013) 23(4) 573-6 [ PubMed ID = 23419515 ] [ RRC reference ]

Lai CM, Lin KY, Kao SH, Chen YN, Huang F, Hsu HJ.
Hedgehog signaling establishes precursors for germline stem cell niches by regulating cell adhesion.
J. Cell Biol. (2017) 216(5) 1439-1453 [ PubMed ID = 28363970 ] [ RRC reference ]

Han H, Pan C, Liu C, Lv X, Yang X, Xiong Y, Lu Y, Wu W, Han J, Zhou Z, Jiang H, Zhang L, Zhao Y.
Gut-neuron interaction via Hh signaling regulates intestinal progenitor cell differentiation in Drosophila.
Cell Discov (2015) 1 15006 [ PubMed ID = 27462407 ] [ RRC reference ]

Tseng CY, Su YH, Yang SM, Lin KY, Lai CM, Rastegari E, Amartuvshin O, Cho Y, Cai Y, Hsu HJ.
Smad-Independent BMP Signaling in Somatic Cells Limits the Size of the Germline Stem Cell Pool.
Stem Cell Reports (2018) 11(3) 811-827 [ PubMed ID = 30122445 ] [ RRC reference ]

Cho Y, Lai CM, Lin KY, Hsu HJ.
A Targeted RNAi Screen Reveals Drosophila Female-Sterile Genes That Control the Size of Germline Stem Cell Niche During Development.
G3 (Bethesda) (2018) 8(7) 2345-2354 [ PubMed ID = 29764959 ] [ RRC reference ]

Tiwari P, Kumar A, Das RN, Malhotra V, VijayRaghavan K.
A Tendon Cell Specific RNAi Screen Reveals Novel Candidates Essential for Muscle Tendon Interaction.
PLoS ONE (2015) 10(10) e0140976 [ PubMed ID = 26488612 ] [ RRC reference ]  
 Comment  
 Sequence (Last Update: July 10, 2007_NCBI RefSeq Release 24)
 Primer Seq. 5'
aaggcctacatggccggaccgAGATAAGGGCAAAGCGCGTGG 
 Primer Seq. 3'
aatctagaggtaccGCGTGATGATCGAGCACGGAA 
 Predicted Fragment Size
500 
 IR fragment full Seq
0001 AGATAAGGGC AAAGCGCGTG GCAGCCGCAC GGNGATCTAT CTGCGATCAG TATTCCAGTC 
0061 CCACCTCGAA ACCCTCGGCA GGCTCCGTGC AAAAGCACGC GGGGCAAGGT GCTATTCGTG 
0121 GCTATCCTGG TGCTGAGCAC CTTCTGCGTC GGCCTGAAGA GCGCCCAGAT CCACTCCAAG 
0181 GTGCACCAGC TGTGGATCCA GGAGGGCGGC CGGCTGGAGG CGGAACTGGC CTACACACAG 
0241 AAGACGATCG GCGAGGACGA GTCGGCCACG CATCAGCTGC TCATTCAGAC GACCCACGAC 
0301 CCGAACGCCT CCGTCCTGCA TCCGCANGCG CTTGCTTGCC CACCTGGAGG TCCTGGTCAA 
0361 GGCCACCGCC GTCAAGGTGC ACCTCTACGA CACCGAATGG GGGCTGCGCG ACATGTGCAA 
0421 CATGCCGAGC ACGCCNTCCT TCGAGGGCAT CTACTACATC GAGCAGATCC TGCGCCACCT 
0481 CATTCCGTGC TCGATCATCN CGN 
 in silico PCR Fragment
0001 AGATAAGGGC AAAGCGCGTG GCAGCCGCAC GGCGATCTAT CTGCGATCAG TATTCCAGTC 
0061 CCACCTCGAA ACCCTCGGCA -GCTCCGTGC AAAAGCACGC -GGGCAAGGT GCTATTCGTG 
0121 GCTATCCTGG TGCTGAGCAC CTTCTGCGTC GGCCTGAAGA GCGCCCAGAT CCACTCCAAG 
0181 GTGCACCAGC TGTGGATCCA GGAGGGCGGC CGGCTGGAGG CGGAACTGGC CTACACACAG 
0241 AAGACGATCG GCGAGGACGA GTCGGCCACG CATCAGCTGC TCATTCAGAC GACCCACGAC 
0301 CCGAACGCCT CCGTCCTGCA TCCGCAGGCG C-TGCTTGCC CACCTGGAGG TCCTGGTCAA 
0361 GGCCACCGCC GTCAAGGTGC ACCTCTACGA CACCGAATGG GGGCTGCGCG ACATGTGCAA 
0421 CATGCCGAGC ACGCCCTCCT TCGAGGGCAT CTACTACATC GAGCAGATCC TGCGCCACCT 
0481 CATTCCGTGC TCGATCATCA CGC 
 Assemble Data

2411R-1.IR_full       1   AGATAAGGGCAAAGCGCGTGGCAGCCGCACGGNGATCTATCTGCGATCAGTATTCCAGTC 60
                          |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||
2411R-1.in silico     1   AGATAAGGGCAAAGCGCGTGGCAGCCGCACGGCGATCTATCTGCGATCAGTATTCCAGTC 60


2411R-1.IR_full       61  CCACCTCGAAACCCTCGGCAGGCTCCGTGCAAAAGCACGCGGGGCAAGGTGCTATTCGTG 120
                          |||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||
2411R-1.in silico     61  CCACCTCGAAACCCTCGGCA-GCTCCGTGCAAAAGCACGC-GGGCAAGGTGCTATTCGTG 120


2411R-1.IR_full       121 GCTATCCTGGTGCTGAGCACCTTCTGCGTCGGCCTGAAGAGCGCCCAGATCCACTCCAAG 180
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2411R-1.in silico     121 GCTATCCTGGTGCTGAGCACCTTCTGCGTCGGCCTGAAGAGCGCCCAGATCCACTCCAAG 180


2411R-1.IR_full       181 GTGCACCAGCTGTGGATCCAGGAGGGCGGCCGGCTGGAGGCGGAACTGGCCTACACACAG 240
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2411R-1.in silico     181 GTGCACCAGCTGTGGATCCAGGAGGGCGGCCGGCTGGAGGCGGAACTGGCCTACACACAG 240


2411R-1.IR_full       241 AAGACGATCGGCGAGGACGAGTCGGCCACGCATCAGCTGCTCATTCAGACGACCCACGAC 300
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2411R-1.in silico     241 AAGACGATCGGCGAGGACGAGTCGGCCACGCATCAGCTGCTCATTCAGACGACCCACGAC 300


2411R-1.IR_full       301 CCGAACGCCTCCGTCCTGCATCCGCANGCGCTTGCTTGCCCACCTGGAGGTCCTGGTCAA 360
                          |||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||
2411R-1.in silico     301 CCGAACGCCTCCGTCCTGCATCCGCAGGCGC-TGCTTGCCCACCTGGAGGTCCTGGTCAA 360


2411R-1.IR_full       361 GGCCACCGCCGTCAAGGTGCACCTCTACGACACCGAATGGGGGCTGCGCGACATGTGCAA 420
                          ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
2411R-1.in silico     361 GGCCACCGCCGTCAAGGTGCACCTCTACGACACCGAATGGGGGCTGCGCGACATGTGCAA 420


2411R-1.IR_full       421 CATGCCGAGCACGCCNTCCTTCGAGGGCATCTACTACATCGAGCAGATCCTGCGCCACCT 480
                          ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||
2411R-1.in silico     421 CATGCCGAGCACGCCCTCCTTCGAGGGCATCTACTACATCGAGCAGATCCTGCGCCACCT 480


2411R-1.IR_full       481 CATTCCGTGCTCGATCATCNCGN 503
                          ||||||||||||||||||| || 
2411R-1.in silico     481 CATTCCGTGCTCGATCATCACGC 503

 
 Off-target information (Last Update: November 4, 2007_NCBI RefSeq Release 26)
 Off-target search result

cv : coefficient of variation

(0 mm hits / total siRNA count)

mm : mismatch
cv 0mm 1mm 2mm 3mm target transcript off target name
100   482  NM_078937.3  CG2411-RA (ptc), mRNA 
0.2   NM_001014668.1  CG8318-RD, transcript variant D (Nf1), mRNA 
0.2   NM_170252.2  CG8318-RC, transcript variant C (Nf1), mRNA 
0   NM_138115.2  CG30421-RA (CG30421), mRNA 
0   NM_001014504.1  CG30372-RB (CG30372), mRNA 
0   NM_079605.2  CG6371-RA (hug), mRNA 
0   NM_134546.3  CG11748-RB, transcript variant B (Obp19a), mRNA 
0   NM_167700.1  CG11748-RA, transcript variant A (Obp19a), mRNA 
0   NM_132504.1  CG11695-RA (CG11695), mRNA 
0   NM_141236.2  CG2503-RA (atms), mRNA 
0   NM_079613.2  CG7642-RA (ry), mRNA 
0   NM_144097.2  CG15357-RA (CG15357), mRNA 
0   NM_138196.1  CG17181-RA (CG17181), mRNA 
0   NM_079320.2  CG10620-RA (Tsf2), mRNA 
0   13  NM_001042804.1  CG2174-RB, transcript variant B (Myo10A), mRNA 
0   13  NM_132441.1  CG2174-RA, transcript variant A (Myo10A), mRNA 
0   NM_141426.1  CG2360-RA (Ccp84Aa), mRNA 
0   NM_206138.1  CG15920-RB, transcript variant B (resilin), mRNA 
0   NM_137313.2  CG15920-RA, transcript variant A (resilin), mRNA 
0   NM_133024.2  CG6769-RA (CG6769), mRNA 
0   NM_079840.2  CG7938-RA (Sry-beta), mRNA 
0   NM_141425.1  CG1252-RA (Ccp84Ab), mRNA 
0   NM_001043201.1  CG32944-RC, transcript variant C (CG32944), mRNA 
0   NM_078509.2  CG3929-RA (dx), mRNA 
0   14  NM_132390.1  CG15306-RA (CG15306), mRNA 
0   NM_143420.2  CG11888-RA (Rpn2), mRNA 
0   NM_057922.3  CG2699-RA (Pi3K21B), mRNA 
0   NM_139894.1  CG8492-RA (CG8492), mRNA 
0   NM_167663.1  CG3917-RB, transcript variant B (Grip84), mRNA 
0   NM_078685.2  CG3917-RC, transcript variant C (Grip84), mRNA 

SHIGEN - SHared Information of GENetic resources - National Institute of Genetics (NIG)
Copyright (c) National Institute of Genetics (NIG)
All rights reserved.
The NIG-Fly is a part of the National BioResource Project which started in 2002.